EMAIL THIS PAGE TO A FRIEND

TSR3

TSR3, 20S rRNA accumulation, homolog (S. cerevisiae)

Synonyms: C16orf42
UniProtKB ID: Q9UJK0, Q6PJT8
Gene ID:
Mouse(68327) TSR3 20S rRNA accumulation
Rat(360494) TSR3, 20S rRNA accumulation
Zebrafish(436643) TSR3, 20S rRNA accumulation, homolog (S. cerevisiae)
dog(479890) TSR3, 20S rRNA accumulation, homolog (S. cerevisiae)
domestic cat(101088542) TSR3, 20S rRNA accumulation, homolog (S. cerevisiae)
domestic guinea pig(100727620) TSR3, 20S rRNA accumulation, homolog (S. cerevisiae)
naked mole-rat(101716750) TSR3, 20S rRNA accumulation, homolog (S. cerevisiae)
cow(508714) TSR3, 20S rRNA accumulation, homolog (S. cerevisiae)
sheep(101108184) TSR3, 20S rRNA accumulation, homolog (S. cerevisiae)
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001410 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001410 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001410 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026676 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026676 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026676 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001410 Rosetta Predictions human pricing
NM_001108268 Rosetta Predictions rat pricing
NM_026676 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180447 predicted 590
2 SASI_Hs01_00180448 predicted 579
3 SASI_Hs01_00180449 predicted 758
4 SASI_Hs01_00180450 predicted 959
5 SASI_Hs01_00180451 predicted 559
6 SASI_Hs01_00180452 predicted 530
7 SASI_Hs01_00180453 predicted 587
8 SASI_Hs01_00180454 predicted 483
9 SASI_Hs01_00180455 predicted 453
10 SASI_Hs01_00180456 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108268 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236984 predicted 657
2 SASI_Rn02_00236985 predicted 490
3 SASI_Rn02_00236986 predicted 369
4 SASI_Rn02_00236987 predicted 590
5 SASI_Rn02_00236988 predicted 432
6 SASI_Rn02_00236989 predicted 1024
7 SASI_Rn02_00236990 predicted 492
8 SASI_Rn02_00236991 predicted 984
9 SASI_Rn02_00236992 predicted 866
10 SASI_Rn02_00236993 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026676 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189136 predicted 493
2 SASI_Mm01_00189137 predicted 212
3 SASI_Mm01_00189138 predicted 730
4 SASI_Mm01_00189140 predicted 773
5 SASI_Mm01_00189141 predicted 335
6 SASI_Mm02_00330704 predicted 839
7 SASI_Mm01_00189142 predicted 895
8 SASI_Mm01_00189143 predicted 274
9 SASI_Mm01_00189144 predicted 231
10 SASI_Mm01_00189145 predicted 518
11 SASI_Mm01_00189139 predicted 933
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001410
VALIDATED
TSR3 MISSION shRNA Bacterial Glycerol Stock
TSR3, 20S rRNA accumulation, homolog (S. cerevisiae)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001410.2-596s1c1
Sequence:CCGGCTTTCCAGACCTTGCTGTCATCTCGAGATGACAGCAAGGTCTGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001410.2-770s21c1
Sequence:CCGGCGATCCCTTCGATGTGGATTCCTCGAGGAATCCACATCGAAGGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001410.2-553s21c1
Sequence:CCGGTTTCCTGCGTGGAAGCGTTTGCTCGAGCAAACGCTTCCACGCAGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001410.2-598s21c1
Sequence:CCGGTTCCAGACCTTGCTGTCATTTCTCGAGAAATGACAGCAAGGTCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001410.2-721s21c1
Sequence:CCGGAGCAGGAGTTCTTGGCCAATGCTCGAGCATTGGCCAAGAACTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001410.2-852s21c1
Sequence:CCGGGATGACAGTGATGCGTCTGAGCTCGAGCTCAGACGCATCACTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001410
VALIDATED
TSR3 MISSION shRNA shRNA Plasmid DNA
TSR3, 20S rRNA accumulation, homolog (S. cerevisiae)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001410.2-596s1c1
Sequence:CCGGCTTTCCAGACCTTGCTGTCATCTCGAGATGACAGCAAGGTCTGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001410.2-770s21c1
Sequence:CCGGCGATCCCTTCGATGTGGATTCCTCGAGGAATCCACATCGAAGGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001410.2-553s21c1
Sequence:CCGGTTTCCTGCGTGGAAGCGTTTGCTCGAGCAAACGCTTCCACGCAGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001410.2-598s21c1
Sequence:CCGGTTCCAGACCTTGCTGTCATTTCTCGAGAAATGACAGCAAGGTCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001410.2-721s21c1
Sequence:CCGGAGCAGGAGTTCTTGGCCAATGCTCGAGCATTGGCCAAGAACTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001410.2-852s21c1
Sequence:CCGGGATGACAGTGATGCGTCTGAGCTCGAGCTCAGACGCATCACTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001410
VALIDATED
TSR3 MISSION shRNA Lentiviral Transduction Particles
TSR3, 20S rRNA accumulation, homolog (S. cerevisiae)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001410.2-596s1c1
Sequence:CCGGCTTTCCAGACCTTGCTGTCATCTCGAGATGACAGCAAGGTCTGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001410.2-770s21c1
Sequence:CCGGCGATCCCTTCGATGTGGATTCCTCGAGGAATCCACATCGAAGGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001410.2-553s21c1
Sequence:CCGGTTTCCTGCGTGGAAGCGTTTGCTCGAGCAAACGCTTCCACGCAGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001410.2-598s21c1
Sequence:CCGGTTCCAGACCTTGCTGTCATTTCTCGAGAAATGACAGCAAGGTCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001410.2-721s21c1
Sequence:CCGGAGCAGGAGTTCTTGGCCAATGCTCGAGCATTGGCCAAGAACTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001410.2-852s21c1
Sequence:CCGGGATGACAGTGATGCGTCTGAGCTCGAGCTCAGACGCATCACTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026676
TSR3 MISSION shRNA Bacterial Glycerol Stock
TSR3, 20S rRNA accumulation, homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026676.1-974s1c1
Sequence:CCGGGCCAGAGACTCCACTGAAATTCTCGAGAATTTCAGTGGAGTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026676.1-445s1c1
Sequence:CCGGCGACACACCCTTTCAGAAGATCTCGAGATCTTCTGAAAGGGTGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026676.1-778s1c1
Sequence:CCGGGCGGGAGTTTGAGAATCTCAACTCGAGTTGAGATTCTCAAACTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026676.1-869s1c1
Sequence:CCGGGATTCTGAGGAGGACAGTGATCTCGAGATCACTGTCCTCCTCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026676.1-743s1c1
Sequence:CCGGGAAGAGGACATCGATCCCTTTCTCGAGAAAGGGATCGATGTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026676.1-503s1c1
Sequence:CCGGGCTGCCAACCCTGTAAACTATCTCGAGATAGTTTACAGGGTTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026676.1-985s1c1
Sequence:CCGGCACTGAAATTTGGAAAGGGATCTCGAGATCCCTTTCCAAATTTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026676.1-827s1c1
Sequence:CCGGGAGGACATGGATGACACTGATCTCGAGATCAGTGTCATCCATGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026676
TSR3 MISSION shRNA shRNA Plasmid DNA
TSR3, 20S rRNA accumulation, homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026676.1-974s1c1
Sequence:CCGGGCCAGAGACTCCACTGAAATTCTCGAGAATTTCAGTGGAGTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026676.1-445s1c1
Sequence:CCGGCGACACACCCTTTCAGAAGATCTCGAGATCTTCTGAAAGGGTGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026676.1-778s1c1
Sequence:CCGGGCGGGAGTTTGAGAATCTCAACTCGAGTTGAGATTCTCAAACTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026676.1-869s1c1
Sequence:CCGGGATTCTGAGGAGGACAGTGATCTCGAGATCACTGTCCTCCTCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026676.1-743s1c1
Sequence:CCGGGAAGAGGACATCGATCCCTTTCTCGAGAAAGGGATCGATGTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026676.1-503s1c1
Sequence:CCGGGCTGCCAACCCTGTAAACTATCTCGAGATAGTTTACAGGGTTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026676.1-985s1c1
Sequence:CCGGCACTGAAATTTGGAAAGGGATCTCGAGATCCCTTTCCAAATTTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026676.1-827s1c1
Sequence:CCGGGAGGACATGGATGACACTGATCTCGAGATCAGTGTCATCCATGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026676
TSR3 MISSION shRNA Lentiviral Transduction Particles
TSR3, 20S rRNA accumulation, homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026676.1-974s1c1
Sequence:CCGGGCCAGAGACTCCACTGAAATTCTCGAGAATTTCAGTGGAGTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026676.1-445s1c1
Sequence:CCGGCGACACACCCTTTCAGAAGATCTCGAGATCTTCTGAAAGGGTGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026676.1-778s1c1
Sequence:CCGGGCGGGAGTTTGAGAATCTCAACTCGAGTTGAGATTCTCAAACTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026676.1-869s1c1
Sequence:CCGGGATTCTGAGGAGGACAGTGATCTCGAGATCACTGTCCTCCTCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026676.1-743s1c1
Sequence:CCGGGAAGAGGACATCGATCCCTTTCTCGAGAAAGGGATCGATGTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026676.1-503s1c1
Sequence:CCGGGCTGCCAACCCTGTAAACTATCTCGAGATAGTTTACAGGGTTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026676.1-985s1c1
Sequence:CCGGCACTGAAATTTGGAAAGGGATCTCGAGATCCCTTTCCAAATTTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026676.1-827s1c1
Sequence:CCGGGAGGACATGGATGACACTGATCTCGAGATCAGTGTCATCCATGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks