EMAIL THIS PAGE TO A FRIEND

TSSC1

tumor suppressing subtransferable candidate 1

UniProtKB ID: Q53HC9, D6W4Y1, O43179, Q53S19, Q53SG2
Gene ID:
Human(7260) Summary: This gene has been reported in PMID 9403053 as one of several tumor-suppressing subtransferable fragments located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian, and breast cancer. Alignment of this gene to genomic sequence data suggests that this gene resides on chromosome 2 rather than chromosome 11. [provided by RefSeq, Dec 2008]
Mouse(380752) tumor suppressing subtransferable candidate 1
Rat(362721) tumor suppressing subtransferable candidate 1
Zebrafish(450045) tumor suppressing subtransferable candidate 1
chicken(421916) tumor suppressing subtransferable candidate 1
domestic cat(101098218) tumor suppressing subtransferable candidate 1
Horse(100072854) tumor suppressing subtransferable candidate 1
dog(475646) tumor suppressing subtransferable candidate 1
cow(613935) tumor suppressing subtransferable candidate 1
sheep(101113469) tumor suppressing subtransferable candidate 1
naked mole-rat(101716600) tumor suppressing subtransferable candidate 1
domestic guinea pig(100731536) tumor suppressing subtransferable candidate 1
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_201357 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201357 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201357 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003310 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003310 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003310 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003310 Rosetta Predictions human pricing
NM_001012192 Rosetta Predictions rat pricing
XM_576012 Rosetta Predictions rat pricing
NM_201357 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003310 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177151 predicted 1321
2 SASI_Hs01_00177152 predicted 900
3 SASI_Hs01_00177153 predicted 1362
4 SASI_Hs01_00177154 predicted 1378
5 SASI_Hs01_00177155 predicted 218
6 SASI_Hs01_00177156 predicted 201
7 SASI_Hs01_00177157 predicted 341
8 SASI_Hs01_00177158 predicted 989
9 SASI_Hs01_00177159 predicted 805
10 SASI_Hs01_00177160 predicted 862
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012192 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107277 predicted 706
2 SASI_Rn01_00107278 predicted 1035
3 SASI_Rn01_00107279 predicted 328
4 SASI_Rn01_00107280 predicted 1172
5 SASI_Rn01_00107281 predicted 375
6 SASI_Rn01_00107282 predicted 1146
7 SASI_Rn02_00200411 predicted 506
8 SASI_Rn01_00107283 predicted 1324
9 SASI_Rn01_00107285 predicted 791
10 SASI_Rn01_00107286 predicted 719
11 SASI_Rn01_00107284 predicted 1343
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576012 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00194151 predicted 330
2 SASI_Rn01_00194152 predicted 429
3 SASI_Rn01_00194153 predicted 332
4 SASI_Rn01_00194154 predicted 402
5 SASI_Rn01_00194155 predicted 430
6 SASI_Rn01_00194156 predicted 273
7 SASI_Rn01_00194157 predicted 435
8 SASI_Rn01_00194158 predicted 345
9 SASI_Rn01_00194159 predicted 432
10 SASI_Rn01_00194160 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201357 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029551 predicted 1305
2 SASI_Mm01_00029552 predicted 1317
3 SASI_Mm01_00029553 predicted 547
4 SASI_Mm01_00029554 predicted 1342
5 SASI_Mm01_00029555 predicted 1355
6 SASI_Mm01_00029556 predicted 986
7 SASI_Mm01_00029557 predicted 1025
8 SASI_Mm01_00029558 predicted 200
9 SASI_Mm02_00351514 predicted 1271
10 SASI_Mm01_00029559 predicted 395
11 SASI_Mm01_00029550 predicted 1176
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201357
VALIDATED
TSSC1 MISSION shRNA Bacterial Glycerol Stock
tumor suppressing subtransferable candidate 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201357.2-572s21c1
Sequence:CCGGGGGATGGGAAGAAGGTCATTTCTCGAGAAATGACCTTCTTCCCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201357.1-222s21c1
Sequence:CCGGCAGATCCACATCATAGACTTTCTCGAGAAAGTCTATGATGTGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201357.1-1096s21c2
Sequence:CCGGCCCTGCAGGACAACGTTATTGCTCGAGCAATAACGTTGTCCTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306662    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201357.1-1303s21c1
Sequence:CCGGATCTGCAGCTACGAGGTAATTCTCGAGAATTACCTCGTAGCTGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201357.1-1174s21c1
Sequence:CCGGCATGGCTGTTTGCTTCCCTAACTCGAGTTAGGGAAGCAAACAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201357.1-752s21c1
Sequence:CCGGCCAGATATACTGCATAGAGAACTCGAGTTCTCTATGCAGTATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201357.1-752s1c1
Sequence:CCGGCCAGATATACTGCATAGAGAACTCGAGTTCTCTATGCAGTATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201357.1-403s1c1
Sequence:CCGGCCAAGGAATTAGAATCCGGTACTCGAGTACCGGATTCTAATTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201357.1-222s1c1
Sequence:CCGGCAGATCCACATCATAGACTTTCTCGAGAAAGTCTATGATGTGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201357.1-1174s1c1
Sequence:CCGGCATGGCTGTTTGCTTCCCTAACTCGAGTTAGGGAAGCAAACAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201357.1-1230s1c1
Sequence:CCGGAGGGCACTGAAGTACCACATACTCGAGTATGTGGTACTTCAGTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201357
VALIDATED
TSSC1 MISSION shRNA shRNA Plasmid DNA
tumor suppressing subtransferable candidate 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201357.2-572s21c1
Sequence:CCGGGGGATGGGAAGAAGGTCATTTCTCGAGAAATGACCTTCTTCCCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201357.1-222s21c1
Sequence:CCGGCAGATCCACATCATAGACTTTCTCGAGAAAGTCTATGATGTGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201357.1-1096s21c2
Sequence:CCGGCCCTGCAGGACAACGTTATTGCTCGAGCAATAACGTTGTCCTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306662    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201357.1-1303s21c1
Sequence:CCGGATCTGCAGCTACGAGGTAATTCTCGAGAATTACCTCGTAGCTGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201357.1-1174s21c1
Sequence:CCGGCATGGCTGTTTGCTTCCCTAACTCGAGTTAGGGAAGCAAACAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201357.1-752s21c1
Sequence:CCGGCCAGATATACTGCATAGAGAACTCGAGTTCTCTATGCAGTATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201357.1-752s1c1
Sequence:CCGGCCAGATATACTGCATAGAGAACTCGAGTTCTCTATGCAGTATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201357.1-403s1c1
Sequence:CCGGCCAAGGAATTAGAATCCGGTACTCGAGTACCGGATTCTAATTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201357.1-222s1c1
Sequence:CCGGCAGATCCACATCATAGACTTTCTCGAGAAAGTCTATGATGTGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201357.1-1174s1c1
Sequence:CCGGCATGGCTGTTTGCTTCCCTAACTCGAGTTAGGGAAGCAAACAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201357.1-1230s1c1
Sequence:CCGGAGGGCACTGAAGTACCACATACTCGAGTATGTGGTACTTCAGTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201357
VALIDATED
TSSC1 MISSION shRNA Lentiviral Transduction Particles
tumor suppressing subtransferable candidate 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201357.2-572s21c1
Sequence:CCGGGGGATGGGAAGAAGGTCATTTCTCGAGAAATGACCTTCTTCCCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201357.1-222s21c1
Sequence:CCGGCAGATCCACATCATAGACTTTCTCGAGAAAGTCTATGATGTGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201357.1-1096s21c2
Sequence:CCGGCCCTGCAGGACAACGTTATTGCTCGAGCAATAACGTTGTCCTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306662    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201357.1-1303s21c1
Sequence:CCGGATCTGCAGCTACGAGGTAATTCTCGAGAATTACCTCGTAGCTGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201357.1-1174s21c1
Sequence:CCGGCATGGCTGTTTGCTTCCCTAACTCGAGTTAGGGAAGCAAACAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201357.1-752s21c1
Sequence:CCGGCCAGATATACTGCATAGAGAACTCGAGTTCTCTATGCAGTATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201357.1-752s1c1
Sequence:CCGGCCAGATATACTGCATAGAGAACTCGAGTTCTCTATGCAGTATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201357.1-403s1c1
Sequence:CCGGCCAAGGAATTAGAATCCGGTACTCGAGTACCGGATTCTAATTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201357.1-222s1c1
Sequence:CCGGCAGATCCACATCATAGACTTTCTCGAGAAAGTCTATGATGTGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201357.1-1174s1c1
Sequence:CCGGCATGGCTGTTTGCTTCCCTAACTCGAGTTAGGGAAGCAAACAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201357.1-1230s1c1
Sequence:CCGGAGGGCACTGAAGTACCACATACTCGAGTATGTGGTACTTCAGTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003310
VALIDATED
TSSC1 MISSION shRNA Bacterial Glycerol Stock
tumor suppressing subtransferable candidate 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003310.2-1087s21c1
Sequence:CCGGCCTTTCCAACATGGTGTCCATCTCGAGATGGACACCATGTTGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003310.2-294s21c1
Sequence:CCGGCGCAGTCTCTTAAATATGATACTCGAGTATCATATTTAAGAGACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003310.2-847s21c1
Sequence:CCGGCCAGATCTACTGCATAGAGAACTCGAGTTCTCTATGCAGTAGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003310.2-892s21c1
Sequence:CCGGCCTTGACTTTAATCCCAATAACTCGAGTTATTGGGATTAAAGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003310.1-805s1c1
Sequence:CCGGCCAGATCTACTGCATAGAGAACTCGAGTTCTCTATGCAGTAGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003310.1-850s1c1
Sequence:CCGGCCTTGACTTTAATCCCAATAACTCGAGTTATTGGGATTAAAGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003310.1-1045s1c1
Sequence:CCGGCCTTTCCAACATGGTGTCCATCTCGAGATGGACACCATGTTGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003310.1-252s1c1
Sequence:CCGGCGCAGTCTCTTAAATATGATACTCGAGTATCATATTTAAGAGACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003310.1-341s1c1
Sequence:CCGGGCGGGTGAAATCTGGCATATTCTCGAGAATATGCCAGATTTCACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003310
VALIDATED
TSSC1 MISSION shRNA shRNA Plasmid DNA
tumor suppressing subtransferable candidate 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003310.2-1087s21c1
Sequence:CCGGCCTTTCCAACATGGTGTCCATCTCGAGATGGACACCATGTTGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003310.2-294s21c1
Sequence:CCGGCGCAGTCTCTTAAATATGATACTCGAGTATCATATTTAAGAGACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003310.2-847s21c1
Sequence:CCGGCCAGATCTACTGCATAGAGAACTCGAGTTCTCTATGCAGTAGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003310.2-892s21c1
Sequence:CCGGCCTTGACTTTAATCCCAATAACTCGAGTTATTGGGATTAAAGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003310.1-805s1c1
Sequence:CCGGCCAGATCTACTGCATAGAGAACTCGAGTTCTCTATGCAGTAGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003310.1-850s1c1
Sequence:CCGGCCTTGACTTTAATCCCAATAACTCGAGTTATTGGGATTAAAGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003310.1-1045s1c1
Sequence:CCGGCCTTTCCAACATGGTGTCCATCTCGAGATGGACACCATGTTGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003310.1-252s1c1
Sequence:CCGGCGCAGTCTCTTAAATATGATACTCGAGTATCATATTTAAGAGACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003310.1-341s1c1
Sequence:CCGGGCGGGTGAAATCTGGCATATTCTCGAGAATATGCCAGATTTCACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003310
VALIDATED
TSSC1 MISSION shRNA Lentiviral Transduction Particles
tumor suppressing subtransferable candidate 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003310.2-1087s21c1
Sequence:CCGGCCTTTCCAACATGGTGTCCATCTCGAGATGGACACCATGTTGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003310.2-294s21c1
Sequence:CCGGCGCAGTCTCTTAAATATGATACTCGAGTATCATATTTAAGAGACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003310.2-847s21c1
Sequence:CCGGCCAGATCTACTGCATAGAGAACTCGAGTTCTCTATGCAGTAGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003310.2-892s21c1
Sequence:CCGGCCTTGACTTTAATCCCAATAACTCGAGTTATTGGGATTAAAGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003310.1-805s1c1
Sequence:CCGGCCAGATCTACTGCATAGAGAACTCGAGTTCTCTATGCAGTAGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003310.1-850s1c1
Sequence:CCGGCCTTGACTTTAATCCCAATAACTCGAGTTATTGGGATTAAAGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003310.1-1045s1c1
Sequence:CCGGCCTTTCCAACATGGTGTCCATCTCGAGATGGACACCATGTTGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003310.1-252s1c1
Sequence:CCGGCGCAGTCTCTTAAATATGATACTCGAGTATCATATTTAAGAGACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003310.1-341s1c1
Sequence:CCGGGCGGGTGAAATCTGGCATATTCTCGAGAATATGCCAGATTTCACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks