EMAIL THIS PAGE TO A FRIEND

TSSC4

tumor suppressing subtransferable candidate 4

UniProtKB ID: Q9Y5U2, C9JS66, Q86VL2, Q9BRS6
Gene ID:
Human(10078) Summary: This gene is one of several tumor-suppressing subtransferable fragments located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian, and breast cancer. This gene is located among several imprinted genes; however, this gene, as well as the pan-hematopoietic expression gene (PHEMX), escapes imprinting. This gene may play a role in malignancies and disease that involve this region. [provided by RefSeq, Jul 2008]
Mouse(56844) tumor-suppressing subchromosomal transferable fragment 4
Rat(361682) tumor suppressing subtransferable candidate 4
chicken(423092) tumor suppressing subtransferable candidate 4
domestic cat(101090213) tumor suppressing subtransferable candidate 4
dog(611611) tumor suppressing subtransferable candidate 4
domestic guinea pig(100720608) tumor suppressing subtransferable candidate 4
naked mole-rat(101723973) tumor suppressing subtransferable candidate 4
cow(509559) tumor suppressing subtransferable candidate 4
sheep(101120122) tumor suppressing subtransferable candidate 4
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020285 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020285 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020285 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005706 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005706 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005706 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005706 Rosetta Predictions human pricing
NM_001013194 Rosetta Predictions rat pricing
NM_001115085 Rosetta Predictions mouse pricing
NM_020285 Rosetta Predictions mouse pricing
NM_138631 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241488 predicted 423
2 SASI_Hs02_00340118 predicted 302
3 SASI_Hs01_00241489 predicted 351
4 SASI_Hs02_00340119 predicted 666
5 SASI_Hs01_00241493 predicted 224
6 SASI_Hs01_00241494 predicted 518
7 SASI_Hs01_00241495 predicted 425
8 SASI_Hs02_00340120 predicted 669
9 SASI_Hs02_00340121 predicted 233
10 SASI_Hs02_00340122 predicted 289
11 SASI_Hs01_00241486 predicted 1035
12 SASI_Hs01_00241487 predicted 768
13 SASI_Hs01_00241490 predicted 1118
14 SASI_Hs01_00241491 predicted 1115
15 SASI_Hs01_00241492 predicted 1027
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013194 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031214 predicted 480
2 SASI_Rn01_00031215 predicted 731
3 SASI_Rn01_00031216 predicted 1111
4 SASI_Rn01_00031217 predicted 482
5 SASI_Rn01_00031218 predicted 712
6 SASI_Rn01_00031219 predicted 1133
7 SASI_Rn02_00200957 predicted 1030
8 SASI_Rn01_00031220 predicted 915
9 SASI_Rn02_00200958 predicted 281
10 SASI_Rn01_00031221 predicted 348
11 SASI_Rn01_00031213 predicted 731
12 SASI_Rn01_00031222 predicted 1134
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115085 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308937 predicted 724
2 SASI_Mm02_00308938 predicted 1068
3 SASI_Mm02_00308939 predicted 715
4 SASI_Mm02_00308940 predicted 848
5 SASI_Mm02_00308941 predicted 799
6 SASI_Mm02_00308942 predicted 881
7 SASI_Mm02_00308943 predicted 703
8 SASI_Mm02_00308944 predicted 473
9 SASI_Mm02_00308945 predicted 694
10 SASI_Mm02_00308946 predicted 900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020285 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022745 predicted 747
2 SASI_Mm01_00022746 predicted 1100
3 SASI_Mm01_00022747 predicted 745
4 SASI_Mm01_00022748 predicted 877
5 SASI_Mm01_00022749 predicted 827
6 SASI_Mm01_00022750 predicted 912
7 SASI_Mm01_00022751 predicted 738
8 SASI_Mm01_00022752 predicted 494
9 SASI_Mm01_00022753 predicted 723
10 SASI_Mm01_00022754 predicted 926
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138631 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028602 predicted 347
2 SASI_Mm02_00339686 predicted 276
3 SASI_Mm02_00339687 predicted 337
4 SASI_Mm01_00028607 predicted 297
5 SASI_Mm01_00028608 predicted 368
6 SASI_Mm02_00339688 predicted 276
7 SASI_Mm02_00339689 predicted 368
8 SASI_Mm02_00339690 predicted 306
9 SASI_Mm02_00339691 predicted 356
10 SASI_Mm02_00339692 predicted 301
11 SASI_Mm01_00028603 predicted 605
12 SASI_Mm01_00028604 predicted 494
13 SASI_Mm01_00028605 predicted 508
14 SASI_Mm01_00028606 predicted 532
15 SASI_Mm01_00028609 predicted 650
16 SASI_Mm01_00028610 predicted 504
17 SASI_Mm01_00028611 predicted 539
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020285
TSSC4 MISSION shRNA Bacterial Glycerol Stock
tumor suppressing subtransferable candidate 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020285.1-590s1c1
Sequence:CCGGCCAAACCAGTGTGAGTGACAACTCGAGTTGTCACTCACACTGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020285.1-352s1c1
Sequence:CCGGACTCGGACCTTAGCTTACCTACTCGAGTAGGTAAGCTAAGGTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020285.1-932s1c1
Sequence:CCGGTGAGAGGAAGAGGGTCCTAAACTCGAGTTTAGGACCCTCTTCCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020285.1-835s1c1
Sequence:CCGGACACAGACTATGTGCCTTCTTCTCGAGAAGAAGGCACATAGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020285.1-500s1c1
Sequence:CCGGCCGAGGCATGAGTTCTACCTTCTCGAGAAGGTAGAACTCATGCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020285
TSSC4 MISSION shRNA shRNA Plasmid DNA
tumor suppressing subtransferable candidate 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020285.1-590s1c1
Sequence:CCGGCCAAACCAGTGTGAGTGACAACTCGAGTTGTCACTCACACTGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020285.1-352s1c1
Sequence:CCGGACTCGGACCTTAGCTTACCTACTCGAGTAGGTAAGCTAAGGTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020285.1-932s1c1
Sequence:CCGGTGAGAGGAAGAGGGTCCTAAACTCGAGTTTAGGACCCTCTTCCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020285.1-835s1c1
Sequence:CCGGACACAGACTATGTGCCTTCTTCTCGAGAAGAAGGCACATAGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020285.1-500s1c1
Sequence:CCGGCCGAGGCATGAGTTCTACCTTCTCGAGAAGGTAGAACTCATGCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020285
TSSC4 MISSION shRNA Lentiviral Transduction Particles
tumor suppressing subtransferable candidate 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020285.1-590s1c1
Sequence:CCGGCCAAACCAGTGTGAGTGACAACTCGAGTTGTCACTCACACTGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020285.1-352s1c1
Sequence:CCGGACTCGGACCTTAGCTTACCTACTCGAGTAGGTAAGCTAAGGTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020285.1-932s1c1
Sequence:CCGGTGAGAGGAAGAGGGTCCTAAACTCGAGTTTAGGACCCTCTTCCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020285.1-835s1c1
Sequence:CCGGACACAGACTATGTGCCTTCTTCTCGAGAAGAAGGCACATAGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020285.1-500s1c1
Sequence:CCGGCCGAGGCATGAGTTCTACCTTCTCGAGAAGGTAGAACTCATGCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005706
TSSC4 MISSION shRNA Bacterial Glycerol Stock
tumor suppressing subtransferable candidate 4
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005706.2-350s1c1
Sequence:CCGGGAGGAGGATTCAGGTCCTGATCTCGAGATCAGGACCTGAATCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005706.2-460s1c1
Sequence:CCGGCCGTGACATCTTTGACTGCCTCTCGAGAGGCAGTCAAAGATGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005706.2-1072s1c1
Sequence:CCGGGCCGGTGGAAACTGTTGGCTTCTCGAGAAGCCAACAGTTTCCACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005706.2-526s1c1
Sequence:CCGGCATGAGTGACAACGGAGGCTTCTCGAGAAGCCTCCGTTGTCACTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005706.2-815s1c1
Sequence:CCGGAGGGTCATCTTCACCAAACCACTCGAGTGGTTTGGTGAAGATGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005706.2-1116s21c1
Sequence:CCGGGAGACCACTTCCGGAACAAGACTCGAGTCTTGTTCCGGAAGTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005706.2-407s21c1
Sequence:CCGGACGGTGCAGCCATTCCATCTGCTCGAGCAGATGGAATGGCTGCACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005706.2-909s21c1
Sequence:CCGGTTGGGAATCCTGCCACAGACACTCGAGTGTCTGTGGCAGGATTCCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005706.2-417s21c1
Sequence:CCGGCATTCCATCTGAGAGGCATGACTCGAGTCATGCCTCTCAGATGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005706.2-672s21c1
Sequence:CCGGAGTACAGCCTGGAAGATGTGACTCGAGTCACATCTTCCAGGCTGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005706.2-428s21c1
Sequence:CCGGAGAGGCATGAGCTCCACCTTCCTCGAGGAAGGTGGAGCTCATGCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005706.2-1032s21c1
Sequence:CCGGTGTCAGGGTCTGTCCACAGTGCTCGAGCACTGTGGACAGACCCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005706.2-269s21c1
Sequence:CCGGTCCCTCAGTGACTCGGACTCTCTCGAGAGAGTCCGAGTCACTGAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005706
TSSC4 MISSION shRNA shRNA Plasmid DNA
tumor suppressing subtransferable candidate 4
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005706.2-350s1c1
Sequence:CCGGGAGGAGGATTCAGGTCCTGATCTCGAGATCAGGACCTGAATCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005706.2-460s1c1
Sequence:CCGGCCGTGACATCTTTGACTGCCTCTCGAGAGGCAGTCAAAGATGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005706.2-1072s1c1
Sequence:CCGGGCCGGTGGAAACTGTTGGCTTCTCGAGAAGCCAACAGTTTCCACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005706.2-526s1c1
Sequence:CCGGCATGAGTGACAACGGAGGCTTCTCGAGAAGCCTCCGTTGTCACTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005706.2-815s1c1
Sequence:CCGGAGGGTCATCTTCACCAAACCACTCGAGTGGTTTGGTGAAGATGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005706.2-1116s21c1
Sequence:CCGGGAGACCACTTCCGGAACAAGACTCGAGTCTTGTTCCGGAAGTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005706.2-407s21c1
Sequence:CCGGACGGTGCAGCCATTCCATCTGCTCGAGCAGATGGAATGGCTGCACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005706.2-909s21c1
Sequence:CCGGTTGGGAATCCTGCCACAGACACTCGAGTGTCTGTGGCAGGATTCCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005706.2-417s21c1
Sequence:CCGGCATTCCATCTGAGAGGCATGACTCGAGTCATGCCTCTCAGATGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005706.2-672s21c1
Sequence:CCGGAGTACAGCCTGGAAGATGTGACTCGAGTCACATCTTCCAGGCTGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005706.2-428s21c1
Sequence:CCGGAGAGGCATGAGCTCCACCTTCCTCGAGGAAGGTGGAGCTCATGCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005706.2-1032s21c1
Sequence:CCGGTGTCAGGGTCTGTCCACAGTGCTCGAGCACTGTGGACAGACCCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005706.2-269s21c1
Sequence:CCGGTCCCTCAGTGACTCGGACTCTCTCGAGAGAGTCCGAGTCACTGAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005706
TSSC4 MISSION shRNA Lentiviral Transduction Particles
tumor suppressing subtransferable candidate 4
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005706.2-350s1c1
Sequence:CCGGGAGGAGGATTCAGGTCCTGATCTCGAGATCAGGACCTGAATCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005706.2-460s1c1
Sequence:CCGGCCGTGACATCTTTGACTGCCTCTCGAGAGGCAGTCAAAGATGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005706.2-1072s1c1
Sequence:CCGGGCCGGTGGAAACTGTTGGCTTCTCGAGAAGCCAACAGTTTCCACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005706.2-526s1c1
Sequence:CCGGCATGAGTGACAACGGAGGCTTCTCGAGAAGCCTCCGTTGTCACTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005706.2-815s1c1
Sequence:CCGGAGGGTCATCTTCACCAAACCACTCGAGTGGTTTGGTGAAGATGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005706.2-1116s21c1
Sequence:CCGGGAGACCACTTCCGGAACAAGACTCGAGTCTTGTTCCGGAAGTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005706.2-407s21c1
Sequence:CCGGACGGTGCAGCCATTCCATCTGCTCGAGCAGATGGAATGGCTGCACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005706.2-909s21c1
Sequence:CCGGTTGGGAATCCTGCCACAGACACTCGAGTGTCTGTGGCAGGATTCCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005706.2-417s21c1
Sequence:CCGGCATTCCATCTGAGAGGCATGACTCGAGTCATGCCTCTCAGATGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005706.2-672s21c1
Sequence:CCGGAGTACAGCCTGGAAGATGTGACTCGAGTCACATCTTCCAGGCTGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005706.2-428s21c1
Sequence:CCGGAGAGGCATGAGCTCCACCTTCCTCGAGGAAGGTGGAGCTCATGCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005706.2-1032s21c1
Sequence:CCGGTGTCAGGGTCTGTCCACAGTGCTCGAGCACTGTGGACAGACCCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005706.2-269s21c1
Sequence:CCGGTCCCTCAGTGACTCGGACTCTCTCGAGAGAGTCCGAGTCACTGAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks