EMAIL THIS PAGE TO A FRIEND

TSSK1B

testis-specific serine kinase 1B

Synonyms: SPOGA4 STK22D TSK1 TSSK1
UniProtKB ID: Q9BXA7, B2R8D9
Gene ID:
Human(83942) Summary: TSSK1 belongs to a family of serine/threonine kinases highly expressed in testis (Hao et al., 2004 [PubMed 15044604]
Rat(288358) testis-specific serine kinase 1B
dog(486427) testis-specific serine kinase 1B
cow(529193) testis-specific serine kinase 1B
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032028 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032028 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032028 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU218811 MISSION® esiRNA esiRNA targeting human TSSK1B human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032028 Rosetta Predictions human pricing
NM_001011900 Rosetta Predictions rat pricing
XM_573326 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032028 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136177 predicted 1260
2 SASI_Hs01_00136178 predicted 536
3 SASI_Hs01_00136179 predicted 213
4 SASI_Hs01_00136180 predicted 534
5 SASI_Hs01_00136181 predicted 304
6 SASI_Hs01_00136182 predicted 1433
7 SASI_Hs01_00136183 predicted 335
8 SASI_Hs01_00136184 predicted 1366
9 SASI_Hs01_00136185 predicted 480
10 SASI_Hs01_00136186 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011900 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037568 predicted 1186
2 SASI_Rn01_00037569 predicted 430
3 SASI_Rn01_00037570 predicted 296
4 SASI_Rn01_00037571 predicted 395
5 SASI_Rn01_00037572 predicted 301
6 SASI_Rn01_00037573 predicted 348
7 SASI_Rn01_00037574 predicted 804
8 SASI_Rn01_00037575 predicted 1041
9 SASI_Rn01_00037576 predicted 470
10 SASI_Rn01_00037577 predicted 1038
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573326 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00126325 predicted 355
2 SASI_Rn01_00126326 predicted 467
3 SASI_Rn01_00126327 predicted 478
4 SASI_Rn01_00126328 predicted 336
5 SASI_Rn01_00126329 predicted 441
6 SASI_Rn01_00126330 predicted 350
7 SASI_Rn01_00126331 predicted 394
8 SASI_Rn01_00126332 predicted 299
9 SASI_Rn01_00126333 predicted 343
10 SASI_Rn01_00126334 predicted 385
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032028
TSSK1B MISSION shRNA Bacterial Glycerol Stock
testis-specific serine kinase 1B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037464    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032028.2-1932s1c1
Sequence:CCGGGTAGCATGGCAACTGGAGAAACTCGAGTTTCTCCAGTTGCCATGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032028.2-379s1c1
Sequence:CCGGTGGCAAGGTCTACATCGTCATCTCGAGATGACGATGTAGACCTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032028.2-336s1c1
Sequence:CCGGACTGCTCCATCATTAAGACCTCTCGAGAGGTCTTAATGATGGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032028.2-338s1c1
Sequence:CCGGTGCTCCATCATTAAGACCTACCTCGAGGTAGGTCTTAATGATGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032028.2-775s1c1
Sequence:CCGGCTACGACGACTCCAACATCAACTCGAGTTGATGTTGGAGTCGTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199177    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032028.2-1403s1c1
Sequence:CCGGCCTAGGTGGATGAGGCCAAAGCTCGAGCTTTGGCCTCATCCACCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032028.2-276s1c1
Sequence:CCGGCCGCAGACTTCTTGGAGAAATCTCGAGATTTCTCCAAGAAGTCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194927    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032028.2-1859s1c1
Sequence:CCGGCATTAAGCTTTAAAGTGCTAGCTCGAGCTAGCACTTTAAAGCTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032028.2-312s1c1
Sequence:CCGGTTGAGATTCTGGCCATGTTAACTCGAGTTAACATGGCCAGAATCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032028.2-625s1c1
Sequence:CCGGCAGTGGTCGAATGGCATTAAGCTCGAGCTTAATGCCATTCGACCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032028
TSSK1B MISSION shRNA shRNA Plasmid DNA
testis-specific serine kinase 1B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037464    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032028.2-1932s1c1
Sequence:CCGGGTAGCATGGCAACTGGAGAAACTCGAGTTTCTCCAGTTGCCATGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032028.2-379s1c1
Sequence:CCGGTGGCAAGGTCTACATCGTCATCTCGAGATGACGATGTAGACCTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032028.2-336s1c1
Sequence:CCGGACTGCTCCATCATTAAGACCTCTCGAGAGGTCTTAATGATGGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032028.2-338s1c1
Sequence:CCGGTGCTCCATCATTAAGACCTACCTCGAGGTAGGTCTTAATGATGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032028.2-775s1c1
Sequence:CCGGCTACGACGACTCCAACATCAACTCGAGTTGATGTTGGAGTCGTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199177    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032028.2-1403s1c1
Sequence:CCGGCCTAGGTGGATGAGGCCAAAGCTCGAGCTTTGGCCTCATCCACCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032028.2-276s1c1
Sequence:CCGGCCGCAGACTTCTTGGAGAAATCTCGAGATTTCTCCAAGAAGTCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194927    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032028.2-1859s1c1
Sequence:CCGGCATTAAGCTTTAAAGTGCTAGCTCGAGCTAGCACTTTAAAGCTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032028.2-312s1c1
Sequence:CCGGTTGAGATTCTGGCCATGTTAACTCGAGTTAACATGGCCAGAATCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032028.2-625s1c1
Sequence:CCGGCAGTGGTCGAATGGCATTAAGCTCGAGCTTAATGCCATTCGACCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032028
TSSK1B MISSION shRNA Lentiviral Transduction Particles
testis-specific serine kinase 1B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037464    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032028.2-1932s1c1
Sequence:CCGGGTAGCATGGCAACTGGAGAAACTCGAGTTTCTCCAGTTGCCATGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032028.2-379s1c1
Sequence:CCGGTGGCAAGGTCTACATCGTCATCTCGAGATGACGATGTAGACCTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032028.2-336s1c1
Sequence:CCGGACTGCTCCATCATTAAGACCTCTCGAGAGGTCTTAATGATGGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032028.2-338s1c1
Sequence:CCGGTGCTCCATCATTAAGACCTACCTCGAGGTAGGTCTTAATGATGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032028.2-775s1c1
Sequence:CCGGCTACGACGACTCCAACATCAACTCGAGTTGATGTTGGAGTCGTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199177    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032028.2-1403s1c1
Sequence:CCGGCCTAGGTGGATGAGGCCAAAGCTCGAGCTTTGGCCTCATCCACCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032028.2-276s1c1
Sequence:CCGGCCGCAGACTTCTTGGAGAAATCTCGAGATTTCTCCAAGAAGTCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194927    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032028.2-1859s1c1
Sequence:CCGGCATTAAGCTTTAAAGTGCTAGCTCGAGCTAGCACTTTAAAGCTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032028.2-312s1c1
Sequence:CCGGTTGAGATTCTGGCCATGTTAACTCGAGTTAACATGGCCAGAATCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032028.2-625s1c1
Sequence:CCGGCAGTGGTCGAATGGCATTAAGCTCGAGCTTAATGCCATTCGACCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks