EMAIL THIS PAGE TO A FRIEND

TSSK2

testis-specific serine kinase 2

Synonyms: DGS-G SPOGA2 STK22B TSK2
UniProtKB ID: Q96PF2, Q8IY55
Gene ID:
Human(23617) ################
Mouse(22115) testis-specific serine kinase 2
Rat(304181) testis-specific serine kinase 2
domestic guinea pig(100734948) testis-specific serine kinase 2
cow(101906547) testis-specific serine kinase 2
chicken(101669379) testis-specific serine kinase 2
dog(486426) testis-specific serine kinase 2
domestic cat(101099155) testis-specific serine kinase 2
chicken(101750839) testis-specific serine kinase 2
dog(608391) testis-specific serine kinase 2
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053006 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053006 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053006 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009436 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009436 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009436 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_053006 Rosetta Predictions human pricing
NM_001012019 Rosetta Predictions rat pricing
XM_573325 Rosetta Predictions rat pricing
NM_009436 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053006 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237056 predicted 262
2 SASI_Hs01_00237057 predicted 457
3 SASI_Hs01_00237058 predicted 815
4 SASI_Hs01_00237059 predicted 1094
5 SASI_Hs01_00237060 predicted 535
6 SASI_Hs01_00237061 predicted 616
7 SASI_Hs01_00237062 predicted 311
8 SASI_Hs01_00237063 predicted 831
9 SASI_Hs01_00237064 predicted 303
10 SASI_Hs01_00237065 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012019 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110712 predicted 767
2 SASI_Rn01_00110713 predicted 437
3 SASI_Rn01_00110714 predicted 944
4 SASI_Rn01_00110715 predicted 778
5 SASI_Rn01_00110716 predicted 941
6 SASI_Rn01_00110717 predicted 269
7 SASI_Rn01_00110718 predicted 262
8 SASI_Rn01_00110719 predicted 301
9 SASI_Rn01_00110720 predicted 761
10 SASI_Rn01_00110721 predicted 776
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573325 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00175609 predicted 240
2 SASI_Rn01_00175610 predicted 371
3 SASI_Rn01_00175611 predicted 279
4 SASI_Rn01_00175612 predicted 219
5 SASI_Rn01_00175613 predicted 363
6 SASI_Rn01_00175614 predicted 324
7 SASI_Rn01_00175615 predicted 294
8 SASI_Rn01_00175616 predicted 329
9 SASI_Rn01_00175617 predicted 322
10 SASI_Rn01_00175618 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009436 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164815 predicted 291
2 SASI_Mm01_00164816 predicted 1059
3 SASI_Mm01_00164817 predicted 972
4 SASI_Mm01_00164821 predicted 969
5 SASI_Mm02_00316134 predicted 215
6 SASI_Mm01_00164822 predicted 324
7 SASI_Mm01_00164823 predicted 297
8 SASI_Mm01_00164824 predicted 1063
9 SASI_Mm02_00316135 predicted 792
10 SASI_Mm02_00316136 predicted 330
11 SASI_Mm01_00164818 predicted 227
12 SASI_Mm01_00164819 predicted 314
13 SASI_Mm01_00164820 predicted 1032
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053006
TSSK2 MISSION shRNA Bacterial Glycerol Stock
testis-specific serine kinase 2
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053006.4-1200s21c1
Sequence:GTACCGGGCGTGATCCTGTACATCATGGCTCGAGCCATGATGTACAGGATCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053006.4-712s21c1
Sequence:GTACCGGCAAGATCATCGACCGCAAGAACTCGAGTTCTTGCGGTCGATGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053006.4-1236s21c1
Sequence:GTACCGGCCTATGACGACTCCGACATCACTCGAGTGATGTCGGAGTCGTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053006.4-624s21c1
Sequence:CCGGGTTACATCGTAGGCATCAATCCTCGAGGATTGATGCCTACGATGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053006.4-820s21c1
Sequence:CCGGCGAGATCTTTGAGACCTCTGACTCGAGTCAGAGGTCTCAAAGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053006.4-1659s21c1
Sequence:CCGGCAAGCACCTAGCATGACAATGCTCGAGCATTGTCATGCTAGGTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053006.4-1021s21c1
Sequence:CCGGCCTCGACAAGGACTTCAACATCTCGAGATGTTGAAGTCCTTGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053006.3-1158s1c1
Sequence:CCGGCCATCACATCTCCGGAGCTGACTCGAGTCAGCTCCGGAGATGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053006.3-704s1c1
Sequence:CCGGCCAAGGTGTATGACATCTGGACTCGAGTCCAGATGTCATACACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053006.3-552s1c1
Sequence:CCGGCCTCGACAAGGACTTCAACATCTCGAGATGTTGAAGTCCTTGTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053006.3-959s1c1
Sequence:CCGGCCACGTCTTCTGCCTCCTTCACTCGAGTGAAGGAGGCAGAAGACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053006.3-460s1c1
Sequence:CCGGGCACGCAAGATGTTCCGACAGCTCGAGCTGTCGGAACATCTTGCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053006.3-351s1c1
Sequence:CCGGCGAGATCTTTGAGACCTCTGACTCGAGTCAGAGGTCTCAAAGATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053006.x-321s1c1
Sequence:CCGGTGTCAACCACGGCTCCATCATCTCGAGATGATGGAGCCGTGGTTGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053006.x-269s1c1
Sequence:CCGGCTACTGACTTTGTGGAGAGATCTCGAGATCTCTCCACAAAGTCAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053006.x-268s1c1
Sequence:CCGGCCTACTGACTTTGTGGAGAGACTCGAGTCTCTCCACAAAGTCAGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053006.x-363s1c1
Sequence:CCGGGACCTCTGACGGACGGATCTACTCGAGTAGATCCGTCCGTCAGAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053006.x-329s1c1
Sequence:CCGGACGGCTCCATCATCAAGACTTCTCGAGAAGTCTTGATGATGGAGCCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053006
TSSK2 MISSION shRNA shRNA Plasmid DNA
testis-specific serine kinase 2
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053006.4-1200s21c1
Sequence:GTACCGGGCGTGATCCTGTACATCATGGCTCGAGCCATGATGTACAGGATCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053006.4-712s21c1
Sequence:GTACCGGCAAGATCATCGACCGCAAGAACTCGAGTTCTTGCGGTCGATGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053006.4-1236s21c1
Sequence:GTACCGGCCTATGACGACTCCGACATCACTCGAGTGATGTCGGAGTCGTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053006.4-624s21c1
Sequence:CCGGGTTACATCGTAGGCATCAATCCTCGAGGATTGATGCCTACGATGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053006.4-820s21c1
Sequence:CCGGCGAGATCTTTGAGACCTCTGACTCGAGTCAGAGGTCTCAAAGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053006.4-1659s21c1
Sequence:CCGGCAAGCACCTAGCATGACAATGCTCGAGCATTGTCATGCTAGGTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053006.4-1021s21c1
Sequence:CCGGCCTCGACAAGGACTTCAACATCTCGAGATGTTGAAGTCCTTGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053006.3-1158s1c1
Sequence:CCGGCCATCACATCTCCGGAGCTGACTCGAGTCAGCTCCGGAGATGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053006.3-704s1c1
Sequence:CCGGCCAAGGTGTATGACATCTGGACTCGAGTCCAGATGTCATACACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053006.3-552s1c1
Sequence:CCGGCCTCGACAAGGACTTCAACATCTCGAGATGTTGAAGTCCTTGTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053006.3-959s1c1
Sequence:CCGGCCACGTCTTCTGCCTCCTTCACTCGAGTGAAGGAGGCAGAAGACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053006.3-460s1c1
Sequence:CCGGGCACGCAAGATGTTCCGACAGCTCGAGCTGTCGGAACATCTTGCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053006.3-351s1c1
Sequence:CCGGCGAGATCTTTGAGACCTCTGACTCGAGTCAGAGGTCTCAAAGATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053006.x-321s1c1
Sequence:CCGGTGTCAACCACGGCTCCATCATCTCGAGATGATGGAGCCGTGGTTGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053006.x-269s1c1
Sequence:CCGGCTACTGACTTTGTGGAGAGATCTCGAGATCTCTCCACAAAGTCAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053006.x-268s1c1
Sequence:CCGGCCTACTGACTTTGTGGAGAGACTCGAGTCTCTCCACAAAGTCAGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053006.x-363s1c1
Sequence:CCGGGACCTCTGACGGACGGATCTACTCGAGTAGATCCGTCCGTCAGAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053006.x-329s1c1
Sequence:CCGGACGGCTCCATCATCAAGACTTCTCGAGAAGTCTTGATGATGGAGCCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053006
TSSK2 MISSION shRNA Lentiviral Transduction Particles
testis-specific serine kinase 2
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053006.4-1200s21c1
Sequence:GTACCGGGCGTGATCCTGTACATCATGGCTCGAGCCATGATGTACAGGATCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053006.4-712s21c1
Sequence:GTACCGGCAAGATCATCGACCGCAAGAACTCGAGTTCTTGCGGTCGATGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053006.4-1236s21c1
Sequence:GTACCGGCCTATGACGACTCCGACATCACTCGAGTGATGTCGGAGTCGTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053006.4-624s21c1
Sequence:CCGGGTTACATCGTAGGCATCAATCCTCGAGGATTGATGCCTACGATGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053006.4-820s21c1
Sequence:CCGGCGAGATCTTTGAGACCTCTGACTCGAGTCAGAGGTCTCAAAGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053006.4-1659s21c1
Sequence:CCGGCAAGCACCTAGCATGACAATGCTCGAGCATTGTCATGCTAGGTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053006.4-1021s21c1
Sequence:CCGGCCTCGACAAGGACTTCAACATCTCGAGATGTTGAAGTCCTTGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053006.3-1158s1c1
Sequence:CCGGCCATCACATCTCCGGAGCTGACTCGAGTCAGCTCCGGAGATGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053006.3-704s1c1
Sequence:CCGGCCAAGGTGTATGACATCTGGACTCGAGTCCAGATGTCATACACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053006.3-552s1c1
Sequence:CCGGCCTCGACAAGGACTTCAACATCTCGAGATGTTGAAGTCCTTGTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053006.3-959s1c1
Sequence:CCGGCCACGTCTTCTGCCTCCTTCACTCGAGTGAAGGAGGCAGAAGACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053006.3-460s1c1
Sequence:CCGGGCACGCAAGATGTTCCGACAGCTCGAGCTGTCGGAACATCTTGCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053006.3-351s1c1
Sequence:CCGGCGAGATCTTTGAGACCTCTGACTCGAGTCAGAGGTCTCAAAGATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053006.x-321s1c1
Sequence:CCGGTGTCAACCACGGCTCCATCATCTCGAGATGATGGAGCCGTGGTTGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053006.x-269s1c1
Sequence:CCGGCTACTGACTTTGTGGAGAGATCTCGAGATCTCTCCACAAAGTCAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053006.x-268s1c1
Sequence:CCGGCCTACTGACTTTGTGGAGAGACTCGAGTCTCTCCACAAAGTCAGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053006.x-363s1c1
Sequence:CCGGGACCTCTGACGGACGGATCTACTCGAGTAGATCCGTCCGTCAGAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053006.x-329s1c1
Sequence:CCGGACGGCTCCATCATCAAGACTTCTCGAGAAGTCTTGATGATGGAGCCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009436
TSSK2 MISSION shRNA Bacterial Glycerol Stock
testis-specific serine kinase 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009436.2-208s21c1
Sequence:CCGGATGTGGCAGTCAAGATCATAGCTCGAGCTATGATCTTGACTGCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009436.2-1123s21c1
Sequence:CCGGGAGCTAAAGACCATCACATTTCTCGAGAAATGTGATGGTCTTTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009436.2-299s21c1
Sequence:CCGGCAACCACCGTTCCATCATTAACTCGAGTTAATGATGGAACGGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009436.1-234s1c1
Sequence:CCGGCCGTTCCATCATTAAGACCTACTCGAGTAGGTCTTAATGATGGAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009436.1-1036s1c1
Sequence:CCGGGCTGAGACTTCCAGAGCTAAACTCGAGTTTAGCTCTGGAAGTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009436.1-315s1c1
Sequence:CCGGCGACCTCCTCACGTTCATTAACTCGAGTTAATGAACGTGAGGAGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009436.1-892s1c1
Sequence:CCGGGAAGGCAAGTATCGAGCTGATCTCGAGATCAGCTCGATACTTGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009436.1-173s1c1
Sequence:CCGGCCACTGACTTTGTGGAGAGATCTCGAGATCTCTCCACAAAGTCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009436
TSSK2 MISSION shRNA shRNA Plasmid DNA
testis-specific serine kinase 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009436.2-208s21c1
Sequence:CCGGATGTGGCAGTCAAGATCATAGCTCGAGCTATGATCTTGACTGCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009436.2-1123s21c1
Sequence:CCGGGAGCTAAAGACCATCACATTTCTCGAGAAATGTGATGGTCTTTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009436.2-299s21c1
Sequence:CCGGCAACCACCGTTCCATCATTAACTCGAGTTAATGATGGAACGGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009436.1-234s1c1
Sequence:CCGGCCGTTCCATCATTAAGACCTACTCGAGTAGGTCTTAATGATGGAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009436.1-1036s1c1
Sequence:CCGGGCTGAGACTTCCAGAGCTAAACTCGAGTTTAGCTCTGGAAGTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009436.1-315s1c1
Sequence:CCGGCGACCTCCTCACGTTCATTAACTCGAGTTAATGAACGTGAGGAGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009436.1-892s1c1
Sequence:CCGGGAAGGCAAGTATCGAGCTGATCTCGAGATCAGCTCGATACTTGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009436.1-173s1c1
Sequence:CCGGCCACTGACTTTGTGGAGAGATCTCGAGATCTCTCCACAAAGTCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009436
TSSK2 MISSION shRNA Lentiviral Transduction Particles
testis-specific serine kinase 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009436.2-208s21c1
Sequence:CCGGATGTGGCAGTCAAGATCATAGCTCGAGCTATGATCTTGACTGCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009436.2-1123s21c1
Sequence:CCGGGAGCTAAAGACCATCACATTTCTCGAGAAATGTGATGGTCTTTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009436.2-299s21c1
Sequence:CCGGCAACCACCGTTCCATCATTAACTCGAGTTAATGATGGAACGGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009436.1-234s1c1
Sequence:CCGGCCGTTCCATCATTAAGACCTACTCGAGTAGGTCTTAATGATGGAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009436.1-1036s1c1
Sequence:CCGGGCTGAGACTTCCAGAGCTAAACTCGAGTTTAGCTCTGGAAGTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009436.1-315s1c1
Sequence:CCGGCGACCTCCTCACGTTCATTAACTCGAGTTAATGAACGTGAGGAGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009436.1-892s1c1
Sequence:CCGGGAAGGCAAGTATCGAGCTGATCTCGAGATCAGCTCGATACTTGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009436.1-173s1c1
Sequence:CCGGCCACTGACTTTGTGGAGAGATCTCGAGATCTCTCCACAAAGTCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks