EMAIL THIS PAGE TO A FRIEND

TSSK3

testis-specific serine kinase 3

Synonyms: SPOGA3 STK22C STK22D TSK3
UniProtKB ID: Q96PN8, Q5TEE5
Gene ID:
Human(81629) Summary: This gene encodes a kinase expressed exclusively in the testis that is thought to play a role in either germ cell differentiation or mature sperm function. [provided by RefSeq, Jul 2008]
Mouse(58864) testis-specific serine kinase 3
Rat(297891) testis-specific serine kinase 3
chicken(771376) testis-specific serine kinase 3
domestic cat(101100236) testis-specific serine kinase 3
dog(487308) testis-specific serine kinase 3
cow(538659) testis-specific serine kinase 3
sheep(101114422) testis-specific serine kinase 3
domestic guinea pig(100732757) testis-specific serine kinase 3
naked mole-rat(101717657) testis-specific serine kinase 3
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052841 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052841 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052841 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080442 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080442 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080442 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021479 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021479 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021479 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052841 Rosetta Predictions human pricing
NM_001007650 Rosetta Predictions rat pricing
XM_579180 Rosetta Predictions rat pricing
NM_080442 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052841 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118826 predicted 575
2 SASI_Hs01_00118827 predicted 577
3 SASI_Hs01_00118828 predicted 671
4 SASI_Hs01_00118829 predicted 865
5 SASI_Hs01_00118830 predicted 546
6 SASI_Hs01_00118832 predicted 866
7 SASI_Hs01_00118833 predicted 851
8 SASI_Hs01_00118834 predicted 1027
9 SASI_Hs01_00118835 predicted 573
10 SASI_Hs02_00361521 predicted 668
11 SASI_Hs01_00118831 predicted 1046
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007650 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198772 predicted 469
2 SASI_Rn01_00083561 predicted 263
3 SASI_Rn01_00083562 predicted 539
4 SASI_Rn01_00083563 predicted 711
5 SASI_Rn01_00083564 predicted 312
6 SASI_Rn01_00083566 predicted 358
7 SASI_Rn01_00083567 predicted 691
8 SASI_Rn01_00083568 predicted 532
9 SASI_Rn01_00083569 predicted 256
10 SASI_Rn02_00198773 predicted 250
11 SASI_Rn01_00083560 predicted 625
12 SASI_Rn01_00083565 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579180 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00197010 predicted 629
2 SASI_Rn01_00197011 predicted 273
3 SASI_Rn01_00197012 predicted 552
4 SASI_Rn01_00197013 predicted 724
5 SASI_Rn01_00197014 predicted 312
6 SASI_Rn01_00197015 predicted 274
7 SASI_Rn01_00197016 predicted 362
8 SASI_Rn01_00197017 predicted 692
9 SASI_Rn01_00197018 predicted 536
10 SASI_Rn01_00197019 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080442 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040331 predicted 294
2 SASI_Mm01_00040332 predicted 292
3 SASI_Mm01_00040333 predicted 503
4 SASI_Mm01_00040334 predicted 616
5 SASI_Mm01_00040335 predicted 573
6 SASI_Mm02_00338098 predicted 498
7 SASI_Mm01_00040336 predicted 386
8 SASI_Mm01_00040337 predicted 752
9 SASI_Mm01_00040338 predicted 589
10 SASI_Mm01_00040339 predicted 518
11 SASI_Mm01_00040330 predicted 664
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052841
TSSK3 MISSION shRNA Bacterial Glycerol Stock
testis-specific serine kinase 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052841.x-872s1c1
Sequence:CCGGGAAGAAGTTAGTTGGCATCCACTCGAGTGGATGCCAACTAACTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052841.x-238s1c1
Sequence:CCGGAGGGCCAGAAGAGTTTATCCACTCGAGTGGATAAACTCTTCTGGCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052841.x-242s1c1
Sequence:CCGGCCAGAAGAGTTTATCCAGAGACTCGAGTCTCTGGATAAACTCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052841.x-243s1c1
Sequence:CCGGCAGAAGAGTTTATCCAGAGATCTCGAGATCTCTGGATAAACTCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052841.x-923s1c1
Sequence:CCGGCAAGTGCTCTCCAATAAAGTACTCGAGTACTTTATTGGAGAGCACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052841.3-796s1c1
Sequence:CCGGGTTGAGGCCATCCGCTACTGCCTCGAGGCAGTAGCGGATGGCCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052841.3-939s1c1
Sequence:CCGGCCAGACCTTCTGCGGCAGTACCTCGAGGTACTGCCGCAGAAGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052841.3-644s1c1
Sequence:CCGGAGAACATCATCCAGGTGTATGCTCGAGCATACACCTGGATGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052841.3-878s1c1
Sequence:CCGGACCTGAAGCTGACTGACTTTGCTCGAGCAAAGTCAGTCAGCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052841.3-774s1c1
Sequence:UNK
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052841
TSSK3 MISSION shRNA shRNA Plasmid DNA
testis-specific serine kinase 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052841.x-872s1c1
Sequence:CCGGGAAGAAGTTAGTTGGCATCCACTCGAGTGGATGCCAACTAACTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052841.x-238s1c1
Sequence:CCGGAGGGCCAGAAGAGTTTATCCACTCGAGTGGATAAACTCTTCTGGCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052841.x-242s1c1
Sequence:CCGGCCAGAAGAGTTTATCCAGAGACTCGAGTCTCTGGATAAACTCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052841.x-243s1c1
Sequence:CCGGCAGAAGAGTTTATCCAGAGATCTCGAGATCTCTGGATAAACTCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052841.x-923s1c1
Sequence:CCGGCAAGTGCTCTCCAATAAAGTACTCGAGTACTTTATTGGAGAGCACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052841.3-796s1c1
Sequence:CCGGGTTGAGGCCATCCGCTACTGCCTCGAGGCAGTAGCGGATGGCCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052841.3-939s1c1
Sequence:CCGGCCAGACCTTCTGCGGCAGTACCTCGAGGTACTGCCGCAGAAGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052841.3-644s1c1
Sequence:CCGGAGAACATCATCCAGGTGTATGCTCGAGCATACACCTGGATGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052841.3-878s1c1
Sequence:CCGGACCTGAAGCTGACTGACTTTGCTCGAGCAAAGTCAGTCAGCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052841.3-774s1c1
Sequence:UNK
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052841
TSSK3 MISSION shRNA Lentiviral Transduction Particles
testis-specific serine kinase 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052841.x-872s1c1
Sequence:CCGGGAAGAAGTTAGTTGGCATCCACTCGAGTGGATGCCAACTAACTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052841.x-238s1c1
Sequence:CCGGAGGGCCAGAAGAGTTTATCCACTCGAGTGGATAAACTCTTCTGGCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052841.x-242s1c1
Sequence:CCGGCCAGAAGAGTTTATCCAGAGACTCGAGTCTCTGGATAAACTCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052841.x-243s1c1
Sequence:CCGGCAGAAGAGTTTATCCAGAGATCTCGAGATCTCTGGATAAACTCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052841.x-923s1c1
Sequence:CCGGCAAGTGCTCTCCAATAAAGTACTCGAGTACTTTATTGGAGAGCACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052841.3-796s1c1
Sequence:CCGGGTTGAGGCCATCCGCTACTGCCTCGAGGCAGTAGCGGATGGCCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052841.3-939s1c1
Sequence:CCGGCCAGACCTTCTGCGGCAGTACCTCGAGGTACTGCCGCAGAAGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052841.3-644s1c1
Sequence:CCGGAGAACATCATCCAGGTGTATGCTCGAGCATACACCTGGATGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052841.3-878s1c1
Sequence:CCGGACCTGAAGCTGACTGACTTTGCTCGAGCAAAGTCAGTCAGCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052841.3-774s1c1
Sequence:UNK
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080442
TSSK3 MISSION shRNA Bacterial Glycerol Stock
testis-specific serine kinase 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080442.1-539s1c1
Sequence:CCGGCCGGGACCTTAAGTGTGAGAACTCGAGTTCTCACACTTAAGGTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080442.1-675s1c1
Sequence:CCGGCCTGAGGTGCTACAGGGCATACTCGAGTATGCCCTGTAGCACCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080442.1-360s1c1
Sequence:CCGGGTGTATGAGATGCTGGAGTCACTCGAGTGACTCCAGCATCTCATACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080442.1-501s1c1
Sequence:CCGGGAGGCTATTCGCTATTGCCATCTCGAGATGGCAATAGCGAATAGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080442.1-296s1c1
Sequence:CCGGCCAGAGATTCCTGCCTCGTGACTCGAGTCACGAGGCAGGAATCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080442
TSSK3 MISSION shRNA shRNA Plasmid DNA
testis-specific serine kinase 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080442.1-539s1c1
Sequence:CCGGCCGGGACCTTAAGTGTGAGAACTCGAGTTCTCACACTTAAGGTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080442.1-675s1c1
Sequence:CCGGCCTGAGGTGCTACAGGGCATACTCGAGTATGCCCTGTAGCACCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080442.1-360s1c1
Sequence:CCGGGTGTATGAGATGCTGGAGTCACTCGAGTGACTCCAGCATCTCATACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080442.1-501s1c1
Sequence:CCGGGAGGCTATTCGCTATTGCCATCTCGAGATGGCAATAGCGAATAGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080442.1-296s1c1
Sequence:CCGGCCAGAGATTCCTGCCTCGTGACTCGAGTCACGAGGCAGGAATCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080442
TSSK3 MISSION shRNA Lentiviral Transduction Particles
testis-specific serine kinase 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080442.1-539s1c1
Sequence:CCGGCCGGGACCTTAAGTGTGAGAACTCGAGTTCTCACACTTAAGGTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080442.1-675s1c1
Sequence:CCGGCCTGAGGTGCTACAGGGCATACTCGAGTATGCCCTGTAGCACCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080442.1-360s1c1
Sequence:CCGGGTGTATGAGATGCTGGAGTCACTCGAGTGACTCCAGCATCTCATACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080442.1-501s1c1
Sequence:CCGGGAGGCTATTCGCTATTGCCATCTCGAGATGGCAATAGCGAATAGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080442.1-296s1c1
Sequence:CCGGCCAGAGATTCCTGCCTCGTGACTCGAGTCACGAGGCAGGAATCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021479
TSSK3 MISSION shRNA Bacterial Glycerol Stock
testis-specific serine kinase 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021479.1-525s1c1
Sequence:CCGGCCTTAAGTGTGAGAACGCCTTCTCGAGAAGGCGTTCTCACACTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021479.1-470s1c1
Sequence:CCGGCCGCCAGATGGTTGAGGCTATCTCGAGATAGCCTCAACCATCTGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021479.1-679s1c1
Sequence:CCGGCATGATAGCAAGAAAGGTGATCTCGAGATCACCTTTCTTGCTATCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021479.1-732s1c1
Sequence:CCGGGCTCTGTGCAAGTCTACCTTTCTCGAGAAAGGTAGACTTGCACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021479.1-809s1c1
Sequence:CCGGCCACTCATTTGGGCATCTCAACTCGAGTTGAGATGCCCAAATGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021479
TSSK3 MISSION shRNA shRNA Plasmid DNA
testis-specific serine kinase 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021479.1-525s1c1
Sequence:CCGGCCTTAAGTGTGAGAACGCCTTCTCGAGAAGGCGTTCTCACACTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021479.1-470s1c1
Sequence:CCGGCCGCCAGATGGTTGAGGCTATCTCGAGATAGCCTCAACCATCTGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021479.1-679s1c1
Sequence:CCGGCATGATAGCAAGAAAGGTGATCTCGAGATCACCTTTCTTGCTATCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021479.1-732s1c1
Sequence:CCGGGCTCTGTGCAAGTCTACCTTTCTCGAGAAAGGTAGACTTGCACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021479.1-809s1c1
Sequence:CCGGCCACTCATTTGGGCATCTCAACTCGAGTTGAGATGCCCAAATGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021479
TSSK3 MISSION shRNA Lentiviral Transduction Particles
testis-specific serine kinase 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021479.1-525s1c1
Sequence:CCGGCCTTAAGTGTGAGAACGCCTTCTCGAGAAGGCGTTCTCACACTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021479.1-470s1c1
Sequence:CCGGCCGCCAGATGGTTGAGGCTATCTCGAGATAGCCTCAACCATCTGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021479.1-679s1c1
Sequence:CCGGCATGATAGCAAGAAAGGTGATCTCGAGATCACCTTTCTTGCTATCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021479.1-732s1c1
Sequence:CCGGGCTCTGTGCAAGTCTACCTTTCTCGAGAAAGGTAGACTTGCACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021479.1-809s1c1
Sequence:CCGGCCACTCATTTGGGCATCTCAACTCGAGTTGAGATGCCCAAATGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks