EMAIL THIS PAGE TO A FRIEND

TSSK4

testis-specific serine kinase 4

Synonyms: C14orf20 STK22E TSK-4 TSK4 TSSK5
UniProtKB ID: Q6SA08, Q2TA60, Q6ZNM2
Gene ID:
Human(283629) Summary: This gene encodes a member of the testis-specific serine/threonine kinase family. The encoded protein is thought to be involved in spermatogenesis via stimulation of the CREB/CRE responsive pathway through phosphorylation of the cAMP responsive element binding protein transcription factor. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Mouse(71099) testis-specific serine kinase 4
Rat(290229) testis-specific serine kinase 4
naked mole-rat(101699791) testis-specific serine kinase 4
domestic guinea pig(100713300) testis-specific serine kinase 4
cow(539477) testis-specific serine kinase 4
sheep(101115710) testis-specific serine kinase 4
domestic cat(101080294) testis-specific serine kinase 4
dog(480262) testis-specific serine kinase 4
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027673 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027673 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027673 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_174944 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174944 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174944 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU071101 MISSION® esiRNA esiRNA human TSSK4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174944 Rosetta Predictions human pricing
NM_001110487 Rosetta Predictions rat pricing
NM_027673 Rosetta Predictions mouse pricing
NM_029596 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174944 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069232 predicted 943
2 SASI_Hs01_00069233 predicted 929
3 SASI_Hs01_00069234 predicted 343
4 SASI_Hs01_00069235 predicted 289
5 SASI_Hs01_00069236 predicted 449
6 SASI_Hs02_00368886 predicted 706
7 SASI_Hs01_00069238 predicted 308
8 SASI_Hs01_00069239 predicted 282
9 SASI_Hs01_00069240 predicted 422
10 SASI_Hs01_00069241 predicted 977
11 SASI_Hs01_00069237 predicted 998
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110487 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251222 predicted 396
2 SASI_Rn02_00251223 predicted 583
3 SASI_Rn02_00251224 predicted 249
4 SASI_Rn02_00251225 predicted 993
5 SASI_Rn02_00251226 predicted 496
6 SASI_Rn02_00251227 predicted 344
7 SASI_Rn02_00251228 predicted 208
8 SASI_Rn02_00251229 predicted 240
9 SASI_Rn02_00251230 predicted 750
10 SASI_Rn02_00251231 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027673 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174429 predicted 747
2 SASI_Mm01_00174430 predicted 913
3 SASI_Mm02_00332564 predicted 706
4 SASI_Mm02_00332565 predicted 712
5 SASI_Mm01_00174432 predicted 878
6 SASI_Mm01_00174434 predicted 864
7 SASI_Mm01_00174435 predicted 422
8 SASI_Mm02_00332566 predicted 485
9 SASI_Mm01_00174437 predicted 435
10 SASI_Mm01_00174438 predicted 605
11 SASI_Mm01_00174431 predicted 284
12 SASI_Mm01_00174433 predicted 234
13 SASI_Mm01_00174436 predicted 209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029596 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335562 predicted 639
2 SASI_Mm02_00335563 predicted 803
3 SASI_Mm02_00335564 predicted 602
4 SASI_Mm02_00335565 predicted 603
5 SASI_Mm02_00335566 predicted 760
6 SASI_Mm02_00335567 predicted 746
7 SASI_Mm02_00335568 predicted 305
8 SASI_Mm02_00335569 predicted 370
9 SASI_Mm02_00335570 predicted 330
10 SASI_Mm02_00335571 predicted 495
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027673
TSSK4 MISSION shRNA Bacterial Glycerol Stock
testis-specific serine kinase 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027673.2-596s21c1
Sequence:CCGGCATCGTGCACCGGGATTTAAACTCGAGTTTAAATCCCGGTGCACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027673.2-498s21c1
Sequence:CCGGCTCGAATGGATCCAACGATATCTCGAGATATCGTTGGATCCATTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027673.2-378s21c1
Sequence:CCGGCCACGTGAGATACAGGTAATGCTCGAGCATTACCTGTATCTCACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027673.1-605s1c1
Sequence:CCGGCCGGGATTTAAAGTTGGAGAACTCGAGTTCTCCAACTTTAAATCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027673.1-497s1c1
Sequence:CCGGCCTCGAATGGATCCAACGATACTCGAGTATCGTTGGATCCATTCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027673.1-233s1c1
Sequence:CCGGGTATGGTTATGAGGTGGGCAACTCGAGTTGCCCACCTCATAACCATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027673.1-350s1c1
Sequence:CCGGCTCTGAAGACTATCTCAACAACTCGAGTTGTTGAGATAGTCTTCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027673.1-700s1c1
Sequence:CCGGCTGTGCATAGTAGCCCTTCTTCTCGAGAAGAAGGGCTACTATGCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027673
TSSK4 MISSION shRNA shRNA Plasmid DNA
testis-specific serine kinase 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027673.2-596s21c1
Sequence:CCGGCATCGTGCACCGGGATTTAAACTCGAGTTTAAATCCCGGTGCACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027673.2-498s21c1
Sequence:CCGGCTCGAATGGATCCAACGATATCTCGAGATATCGTTGGATCCATTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027673.2-378s21c1
Sequence:CCGGCCACGTGAGATACAGGTAATGCTCGAGCATTACCTGTATCTCACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027673.1-605s1c1
Sequence:CCGGCCGGGATTTAAAGTTGGAGAACTCGAGTTCTCCAACTTTAAATCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027673.1-497s1c1
Sequence:CCGGCCTCGAATGGATCCAACGATACTCGAGTATCGTTGGATCCATTCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027673.1-233s1c1
Sequence:CCGGGTATGGTTATGAGGTGGGCAACTCGAGTTGCCCACCTCATAACCATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027673.1-350s1c1
Sequence:CCGGCTCTGAAGACTATCTCAACAACTCGAGTTGTTGAGATAGTCTTCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027673.1-700s1c1
Sequence:CCGGCTGTGCATAGTAGCCCTTCTTCTCGAGAAGAAGGGCTACTATGCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027673
TSSK4 MISSION shRNA Lentiviral Transduction Particles
testis-specific serine kinase 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027673.2-596s21c1
Sequence:CCGGCATCGTGCACCGGGATTTAAACTCGAGTTTAAATCCCGGTGCACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027673.2-498s21c1
Sequence:CCGGCTCGAATGGATCCAACGATATCTCGAGATATCGTTGGATCCATTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027673.2-378s21c1
Sequence:CCGGCCACGTGAGATACAGGTAATGCTCGAGCATTACCTGTATCTCACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027673.1-605s1c1
Sequence:CCGGCCGGGATTTAAAGTTGGAGAACTCGAGTTCTCCAACTTTAAATCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027673.1-497s1c1
Sequence:CCGGCCTCGAATGGATCCAACGATACTCGAGTATCGTTGGATCCATTCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027673.1-233s1c1
Sequence:CCGGGTATGGTTATGAGGTGGGCAACTCGAGTTGCCCACCTCATAACCATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027673.1-350s1c1
Sequence:CCGGCTCTGAAGACTATCTCAACAACTCGAGTTGTTGAGATAGTCTTCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027673.1-700s1c1
Sequence:CCGGCTGTGCATAGTAGCCCTTCTTCTCGAGAAGAAGGGCTACTATGCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174944
TSSK4 MISSION shRNA Bacterial Glycerol Stock
testis-specific serine kinase 4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174944.2-408s1c1
Sequence:CCGGGCGGCACAAGTACCTCATCAACTCGAGTTGATGAGGTACTTGTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174944.2-787s1c1
Sequence:CCGGCCAGAGATCTTACGAGGCTTGCTCGAGCAAGCCTCGTAAGATCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174944.2-279s1c1
Sequence:CCGGGTCGGTATATGAGGCTTTCTACTCGAGTAGAAAGCCTCATATACCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174944.2-217s1c1
Sequence:CCGGCATTCCCTCATGGATGAATATCTCGAGATATTCATCCATGAGGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174944.2-225s1c1
Sequence:CCGGCATGGATGAATATGGTTATGACTCGAGTCATAACCATATTCATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174944.2-457s1c1
Sequence:CCGGCGAGTATACATCATTCTGGAACTCGAGTTCCAGAATGATGTATACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174944.x-626s1c1
Sequence:CCGGTGCTGCTGGTAGGGACTTAAACTCGAGTTTAAGTCCCTACCAGCAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174944.x-1144s1c1
Sequence:CCGGACACCACTAAACAGCACCAATCTCGAGATTGGTGCTGTTTAGTGGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174944.x-1134s1c1
Sequence:CCGGCAGCTCCACAACACCACTAAACTCGAGTTTAGTGGTGTTGTGGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174944.x-495s1c1
Sequence:CCGGTCTCTACCTTGTGCCCTCATACTCGAGTATGAGGGCACAAGGTAGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174944.x-875s1c1
Sequence:CCGGCGTCATCCTTTACACTCTAGTCTCGAGACTAGAGTGTAAAGGATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174944
TSSK4 MISSION shRNA shRNA Plasmid DNA
testis-specific serine kinase 4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174944.2-408s1c1
Sequence:CCGGGCGGCACAAGTACCTCATCAACTCGAGTTGATGAGGTACTTGTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174944.2-787s1c1
Sequence:CCGGCCAGAGATCTTACGAGGCTTGCTCGAGCAAGCCTCGTAAGATCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174944.2-279s1c1
Sequence:CCGGGTCGGTATATGAGGCTTTCTACTCGAGTAGAAAGCCTCATATACCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174944.2-217s1c1
Sequence:CCGGCATTCCCTCATGGATGAATATCTCGAGATATTCATCCATGAGGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174944.2-225s1c1
Sequence:CCGGCATGGATGAATATGGTTATGACTCGAGTCATAACCATATTCATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174944.2-457s1c1
Sequence:CCGGCGAGTATACATCATTCTGGAACTCGAGTTCCAGAATGATGTATACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174944.x-626s1c1
Sequence:CCGGTGCTGCTGGTAGGGACTTAAACTCGAGTTTAAGTCCCTACCAGCAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174944.x-1144s1c1
Sequence:CCGGACACCACTAAACAGCACCAATCTCGAGATTGGTGCTGTTTAGTGGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174944.x-1134s1c1
Sequence:CCGGCAGCTCCACAACACCACTAAACTCGAGTTTAGTGGTGTTGTGGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174944.x-495s1c1
Sequence:CCGGTCTCTACCTTGTGCCCTCATACTCGAGTATGAGGGCACAAGGTAGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174944.x-875s1c1
Sequence:CCGGCGTCATCCTTTACACTCTAGTCTCGAGACTAGAGTGTAAAGGATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174944
TSSK4 MISSION shRNA Lentiviral Transduction Particles
testis-specific serine kinase 4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174944.2-408s1c1
Sequence:CCGGGCGGCACAAGTACCTCATCAACTCGAGTTGATGAGGTACTTGTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174944.2-787s1c1
Sequence:CCGGCCAGAGATCTTACGAGGCTTGCTCGAGCAAGCCTCGTAAGATCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174944.2-279s1c1
Sequence:CCGGGTCGGTATATGAGGCTTTCTACTCGAGTAGAAAGCCTCATATACCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174944.2-217s1c1
Sequence:CCGGCATTCCCTCATGGATGAATATCTCGAGATATTCATCCATGAGGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174944.2-225s1c1
Sequence:CCGGCATGGATGAATATGGTTATGACTCGAGTCATAACCATATTCATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174944.2-457s1c1
Sequence:CCGGCGAGTATACATCATTCTGGAACTCGAGTTCCAGAATGATGTATACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174944.x-626s1c1
Sequence:CCGGTGCTGCTGGTAGGGACTTAAACTCGAGTTTAAGTCCCTACCAGCAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174944.x-1144s1c1
Sequence:CCGGACACCACTAAACAGCACCAATCTCGAGATTGGTGCTGTTTAGTGGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174944.x-1134s1c1
Sequence:CCGGCAGCTCCACAACACCACTAAACTCGAGTTTAGTGGTGTTGTGGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174944.x-495s1c1
Sequence:CCGGTCTCTACCTTGTGCCCTCATACTCGAGTATGAGGGCACAAGGTAGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174944.x-875s1c1
Sequence:CCGGCGTCATCCTTTACACTCTAGTCTCGAGACTAGAGTGTAAAGGATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks