EMAIL THIS PAGE TO A FRIEND

TSSK6

testis-specific serine kinase 6

Synonyms: CT72 SSTK TSSK4
UniProtKB ID: Q9BXA6, B2R9F8, Q6ZMC4, Q96LJ4
Gene ID:
Human(83983) Summary: This intronless gene encodes a member of the CAMK (calcium/calmodulin-dependent) serine/threonine protein kinase family. The encoded kinase has a broad expression pattern but is described as testis-specific due to effects on fertility. Male mice which lack the gene encoding a highly similar protein are sterile and have morphologically abnormal sperm. [provided by RefSeq, Jan 2012]
Mouse(83984) testis-specific serine kinase 6
Rat(290670) testis-specific serine kinase 6
Zebrafish(557915) testis-specific serine kinase 6
chicken(429001) testis-specific serine kinase 6
domestic cat(101099943) testis-specific serine kinase 6
dog(476660) testis-specific serine kinase 6
domestic guinea pig(100719112) testis-specific serine kinase 6
naked mole-rat(101720203) testis-specific serine kinase 6
cow(539707) testis-specific serine kinase 6
sheep(101104825) testis-specific serine kinase 6
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032037 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032037 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032037 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_032004 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_032004 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_032004 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032037 Rosetta Predictions human pricing
NM_001106078 Rosetta Predictions rat pricing
NM_032004 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032037 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190487 predicted 1208
2 SASI_Hs01_00190489 predicted 232
3 SASI_Hs01_00190490 predicted 432
4 SASI_Hs02_00359232 predicted 376
5 SASI_Hs01_00190492 predicted 1124
6 SASI_Hs01_00190493 predicted 278
7 SASI_Hs01_00190494 predicted 458
8 SASI_Hs01_00190495 predicted 972
9 SASI_Hs02_00359233 predicted 478
10 SASI_Hs02_00359234 predicted 313
11 SASI_Hs01_00190488 predicted 683
12 SASI_Hs01_00190491 predicted 471
13 SASI_Hs01_00190496 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106078 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215412 predicted 305
2 SASI_Rn02_00215413 predicted 753
3 SASI_Rn02_00215414 predicted 292
4 SASI_Rn02_00215415 predicted 681
5 SASI_Rn02_00215416 predicted 807
6 SASI_Rn02_00215417 predicted 550
7 SASI_Rn02_00215418 predicted 533
8 SASI_Rn02_00215419 predicted 713
9 SASI_Rn02_00215420 predicted 783
10 SASI_Rn02_00215421 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032004 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055026 predicted 238
2 SASI_Mm01_00055027 predicted 760
3 SASI_Mm01_00055028 predicted 316
4 SASI_Mm01_00055029 predicted 682
5 SASI_Mm01_00055030 predicted 530
6 SASI_Mm01_00055031 predicted 518
7 SASI_Mm01_00055032 predicted 577
8 SASI_Mm01_00055033 predicted 787
9 SASI_Mm01_00055034 predicted 331
10 SASI_Mm01_00055035 predicted 708
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032037
VALIDATED
TSSK6 MISSION shRNA Bacterial Glycerol Stock
testis-specific serine kinase 6
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032037.2-832s21c1
Sequence:CCGGTCGTGCTCTACGTCATGGTCACTCGAGTGACCATGACGTAGAGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032037.2-318s21c1
Sequence:CCGGGCCACATCCAAGAAGTACAAGCTCGAGCTTGTACTTCTTGGATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032037.2-1413s21c1
Sequence:CCGGGAACCTGCAATAAACTCGCTGCTCGAGCAGCGAGTTTATTGCAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_032037.2-296s21c1
Sequence:CCGGCAGCTACTCCAAGGTGAAGGTCTCGAGACCTTCACCTTGGAGTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032037.2-600s21c1
Sequence:CCGGGTGCGCTACCTGCACGATCATCTCGAGATGATCGTGCAGGTAGCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032037.2-281s21c1
Sequence:CCGGCACAATTGGAGAGGGCAGCTACTCGAGTAGCTGCCCTCTCCAATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032037.2-380s21c1
Sequence:CCGGCCCGGACTTCGTCAACAAGTTCTCGAGAACTTGTTGACGAAGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032037.2-482s21c1
Sequence:CCGGCGGGAAACTGTACATCGTGATCTCGAGATCACGATGTACAGTTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037460    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_032037.1-694s1c1
Sequence:CCGGAGAAGTACGATGTGTGGAGCACTCGAGTGCTCCACACATCGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037463    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032037.1-208s1c1
Sequence:CCGGCCACATCCAAGAAGTACAAGGCTCGAGCCTTGTACTTCTTGGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037461    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032037.1-365s1c1
Sequence:CCGGGTGCAACGGGAAACTGTACATCTCGAGATGTACAGTTTCCCGTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037462    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032037.1-692s1c1
Sequence:CCGGCAAGAAGTACGATGTGTGGAGCTCGAGCTCCACACATCGTACTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032037.2-913s1c1
Sequence:CCGGGCGTGCTCTATCCCGAAGGCCCTCGAGGGCCTTCGGGATAGAGCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032037.2-449s1c1
Sequence:CCGGCGTGCACGTCTTCGAGTTCATCTCGAGATGAACTCGAAGACGTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032037.2-830s1c1
Sequence:CCGGCGTCGTGCTCTACGTCATGGTCTCGAGACCATGACGTAGAGCACGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032037.2-381s1c1
Sequence:CCGGCCGGACTTCGTCAACAAGTTCCTCGAGGAACTTGTTGACGAAGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032037.2-405s1c1
Sequence:CCGGCCGCGAGAGCTGTCCATCCTGCTCGAGCAGGATGGACAGCTCTCGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032037.2-1217s1c1
Sequence:CCGGCAGTTGCCCTTGTTCGGAATCCTCGAGGATTCCGAACAAGGGCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032037
VALIDATED
TSSK6 MISSION shRNA shRNA Plasmid DNA
testis-specific serine kinase 6
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032037.2-832s21c1
Sequence:CCGGTCGTGCTCTACGTCATGGTCACTCGAGTGACCATGACGTAGAGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032037.2-318s21c1
Sequence:CCGGGCCACATCCAAGAAGTACAAGCTCGAGCTTGTACTTCTTGGATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032037.2-1413s21c1
Sequence:CCGGGAACCTGCAATAAACTCGCTGCTCGAGCAGCGAGTTTATTGCAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_032037.2-296s21c1
Sequence:CCGGCAGCTACTCCAAGGTGAAGGTCTCGAGACCTTCACCTTGGAGTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032037.2-600s21c1
Sequence:CCGGGTGCGCTACCTGCACGATCATCTCGAGATGATCGTGCAGGTAGCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032037.2-281s21c1
Sequence:CCGGCACAATTGGAGAGGGCAGCTACTCGAGTAGCTGCCCTCTCCAATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032037.2-380s21c1
Sequence:CCGGCCCGGACTTCGTCAACAAGTTCTCGAGAACTTGTTGACGAAGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032037.2-482s21c1
Sequence:CCGGCGGGAAACTGTACATCGTGATCTCGAGATCACGATGTACAGTTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037460    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_032037.1-694s1c1
Sequence:CCGGAGAAGTACGATGTGTGGAGCACTCGAGTGCTCCACACATCGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037463    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032037.1-208s1c1
Sequence:CCGGCCACATCCAAGAAGTACAAGGCTCGAGCCTTGTACTTCTTGGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037461    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032037.1-365s1c1
Sequence:CCGGGTGCAACGGGAAACTGTACATCTCGAGATGTACAGTTTCCCGTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037462    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032037.1-692s1c1
Sequence:CCGGCAAGAAGTACGATGTGTGGAGCTCGAGCTCCACACATCGTACTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032037.2-913s1c1
Sequence:CCGGGCGTGCTCTATCCCGAAGGCCCTCGAGGGCCTTCGGGATAGAGCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032037.2-449s1c1
Sequence:CCGGCGTGCACGTCTTCGAGTTCATCTCGAGATGAACTCGAAGACGTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032037.2-830s1c1
Sequence:CCGGCGTCGTGCTCTACGTCATGGTCTCGAGACCATGACGTAGAGCACGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032037.2-381s1c1
Sequence:CCGGCCGGACTTCGTCAACAAGTTCCTCGAGGAACTTGTTGACGAAGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032037.2-405s1c1
Sequence:CCGGCCGCGAGAGCTGTCCATCCTGCTCGAGCAGGATGGACAGCTCTCGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032037.2-1217s1c1
Sequence:CCGGCAGTTGCCCTTGTTCGGAATCCTCGAGGATTCCGAACAAGGGCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032037
VALIDATED
TSSK6 MISSION shRNA Lentiviral Transduction Particles
testis-specific serine kinase 6
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032037.2-832s21c1
Sequence:CCGGTCGTGCTCTACGTCATGGTCACTCGAGTGACCATGACGTAGAGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032037.2-318s21c1
Sequence:CCGGGCCACATCCAAGAAGTACAAGCTCGAGCTTGTACTTCTTGGATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032037.2-1413s21c1
Sequence:CCGGGAACCTGCAATAAACTCGCTGCTCGAGCAGCGAGTTTATTGCAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_032037.2-296s21c1
Sequence:CCGGCAGCTACTCCAAGGTGAAGGTCTCGAGACCTTCACCTTGGAGTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032037.2-600s21c1
Sequence:CCGGGTGCGCTACCTGCACGATCATCTCGAGATGATCGTGCAGGTAGCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032037.2-281s21c1
Sequence:CCGGCACAATTGGAGAGGGCAGCTACTCGAGTAGCTGCCCTCTCCAATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032037.2-380s21c1
Sequence:CCGGCCCGGACTTCGTCAACAAGTTCTCGAGAACTTGTTGACGAAGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032037.2-482s21c1
Sequence:CCGGCGGGAAACTGTACATCGTGATCTCGAGATCACGATGTACAGTTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037460    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_032037.1-694s1c1
Sequence:CCGGAGAAGTACGATGTGTGGAGCACTCGAGTGCTCCACACATCGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037463    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032037.1-208s1c1
Sequence:CCGGCCACATCCAAGAAGTACAAGGCTCGAGCCTTGTACTTCTTGGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037461    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032037.1-365s1c1
Sequence:CCGGGTGCAACGGGAAACTGTACATCTCGAGATGTACAGTTTCCCGTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037462    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032037.1-692s1c1
Sequence:CCGGCAAGAAGTACGATGTGTGGAGCTCGAGCTCCACACATCGTACTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032037.2-913s1c1
Sequence:CCGGGCGTGCTCTATCCCGAAGGCCCTCGAGGGCCTTCGGGATAGAGCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032037.2-449s1c1
Sequence:CCGGCGTGCACGTCTTCGAGTTCATCTCGAGATGAACTCGAAGACGTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032037.2-830s1c1
Sequence:CCGGCGTCGTGCTCTACGTCATGGTCTCGAGACCATGACGTAGAGCACGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032037.2-381s1c1
Sequence:CCGGCCGGACTTCGTCAACAAGTTCCTCGAGGAACTTGTTGACGAAGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032037.2-405s1c1
Sequence:CCGGCCGCGAGAGCTGTCCATCCTGCTCGAGCAGGATGGACAGCTCTCGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032037.2-1217s1c1
Sequence:CCGGCAGTTGCCCTTGTTCGGAATCCTCGAGGATTCCGAACAAGGGCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032004
TSSK6 MISSION shRNA Bacterial Glycerol Stock
testis-specific serine kinase 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032004.1-824s21c1
Sequence:CCGGTCGCCGAGCTGCTACAGTTCACTCGAGTGAACTGTAGCAGCTCGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032004.1-725s21c1
Sequence:CCGGCCTTCGACGACTCGGACATTGCTCGAGCAATGTCCGAGTCGTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032004.1-690s21c1
Sequence:CCGGCGTTGTGCTCTACGTCATGGTCTCGAGACCATGACGTAGAGCACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032004.1-1119s21c1
Sequence:CCGGGCATGCGCATCCTCGATTTCTCTCGAGAGAAATCGAGGATGCGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032004.1-344s21c1
Sequence:CCGGGGAAGCTGTACATCGTGATGGCTCGAGCCATCACGATGTACAGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032004.1-537s1c1
Sequence:CCGGCCGCGTCAAGATCACGGATTTCTCGAGAAATCCGTGATCTTGACGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032004.1-657s1c1
Sequence:CCGGCGACCCTAAGAAATACGACGTCTCGAGACGTCGTATTTCTTAGGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032004.1-429s1c1
Sequence:CCGGGCGCGAACTCTTCTCGCAGATCTCGAGATCTGCGAGAAGAGTTCGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032004.1-801s1c1
Sequence:CCGGGTCGGAACGATGCAAATCCTTCTCGAGAAGGATTTGCATCGTTCCGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032004.1-322s1c1
Sequence:CCGGGAGTTCATCGAAGTGTGCAATCTCGAGATTGCACACTTCGATGAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032004
TSSK6 MISSION shRNA shRNA Plasmid DNA
testis-specific serine kinase 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032004.1-824s21c1
Sequence:CCGGTCGCCGAGCTGCTACAGTTCACTCGAGTGAACTGTAGCAGCTCGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032004.1-725s21c1
Sequence:CCGGCCTTCGACGACTCGGACATTGCTCGAGCAATGTCCGAGTCGTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032004.1-690s21c1
Sequence:CCGGCGTTGTGCTCTACGTCATGGTCTCGAGACCATGACGTAGAGCACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032004.1-1119s21c1
Sequence:CCGGGCATGCGCATCCTCGATTTCTCTCGAGAGAAATCGAGGATGCGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032004.1-344s21c1
Sequence:CCGGGGAAGCTGTACATCGTGATGGCTCGAGCCATCACGATGTACAGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032004.1-537s1c1
Sequence:CCGGCCGCGTCAAGATCACGGATTTCTCGAGAAATCCGTGATCTTGACGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032004.1-657s1c1
Sequence:CCGGCGACCCTAAGAAATACGACGTCTCGAGACGTCGTATTTCTTAGGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032004.1-429s1c1
Sequence:CCGGGCGCGAACTCTTCTCGCAGATCTCGAGATCTGCGAGAAGAGTTCGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032004.1-801s1c1
Sequence:CCGGGTCGGAACGATGCAAATCCTTCTCGAGAAGGATTTGCATCGTTCCGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032004.1-322s1c1
Sequence:CCGGGAGTTCATCGAAGTGTGCAATCTCGAGATTGCACACTTCGATGAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032004
TSSK6 MISSION shRNA Lentiviral Transduction Particles
testis-specific serine kinase 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032004.1-824s21c1
Sequence:CCGGTCGCCGAGCTGCTACAGTTCACTCGAGTGAACTGTAGCAGCTCGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032004.1-725s21c1
Sequence:CCGGCCTTCGACGACTCGGACATTGCTCGAGCAATGTCCGAGTCGTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032004.1-690s21c1
Sequence:CCGGCGTTGTGCTCTACGTCATGGTCTCGAGACCATGACGTAGAGCACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032004.1-1119s21c1
Sequence:CCGGGCATGCGCATCCTCGATTTCTCTCGAGAGAAATCGAGGATGCGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032004.1-344s21c1
Sequence:CCGGGGAAGCTGTACATCGTGATGGCTCGAGCCATCACGATGTACAGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032004.1-537s1c1
Sequence:CCGGCCGCGTCAAGATCACGGATTTCTCGAGAAATCCGTGATCTTGACGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032004.1-657s1c1
Sequence:CCGGCGACCCTAAGAAATACGACGTCTCGAGACGTCGTATTTCTTAGGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032004.1-429s1c1
Sequence:CCGGGCGCGAACTCTTCTCGCAGATCTCGAGATCTGCGAGAAGAGTTCGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032004.1-801s1c1
Sequence:CCGGGTCGGAACGATGCAAATCCTTCTCGAGAAGGATTTGCATCGTTCCGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032004.1-322s1c1
Sequence:CCGGGAGTTCATCGAAGTGTGCAATCTCGAGATTGCACACTTCGATGAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks