EMAIL THIS PAGE TO A FRIEND

TST

thiosulfate sulfurtransferase (rhodanese)

Synonyms: RDS
UniProtKB ID: Q16762, B3KRM1, Q6IB06
Gene ID:
Human(7263) Summary: This is one of two neighboring genes encoding similar proteins that each contain two rhodanese domains. The encoded protein is localized to the mitochondria and catalyzes the conversion of thiosulfate and cyanide to thiocyanate and sulfite. In addition, the protein interacts with 5S ribosomal RNA and facilitates its import into the mitochondria. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Mouse(22117) thiosulfate sulfurtransferase, mitochondrial
Rat(25274) thiosulfate sulfurtransferase
cow(783512) thiosulfate sulfurtransferase-like
cow(280946) thiosulfate sulfurtransferase (rhodanese)
sheep(101101881) thiosulfate sulfurtransferase (rhodanese)
naked mole-rat(101698078) thiosulfate sulfurtransferase (rhodanese)
domestic guinea pig(100720246) thiosulfate sulfurtransferase (rhodanese)
domestic cat(101095994) thiosulfate sulfurtransferase (rhodanese)
dog(481275) thiosulfate sulfurtransferase (rhodanese)
chicken(418049) thiosulfate sulfurtransferase (rhodanese)
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009437 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009437 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009437 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003312 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003312 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003312 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003312 Rosetta Predictions human pricing
NM_012808 Rosetta Predictions rat pricing
NM_009437 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113318 predicted 369
2 SASI_Hs02_00335432 predicted 234
3 SASI_Hs02_00335433 predicted 236
4 SASI_Hs01_00113319 predicted 739
5 SASI_Hs01_00113320 predicted 219
6 SASI_Hs01_00113322 predicted 508
7 SASI_Hs01_00113323 predicted 511
8 SASI_Hs01_00113324 predicted 372
9 SASI_Hs01_00113325 predicted 578
10 SASI_Hs01_00113326 predicted 435
11 SASI_Hs01_00113317 predicted 683
12 SASI_Hs01_00113321 predicted 699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012808 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100732 predicted 584
2 SASI_Rn01_00100733 predicted 718
3 SASI_Rn01_00100734 predicted 649
4 SASI_Rn01_00100735 predicted 282
5 SASI_Rn01_00100736 predicted 640
6 SASI_Rn01_00100737 predicted 656
7 SASI_Rn01_00100738 predicted 496
8 SASI_Rn01_00100739 predicted 354
9 SASI_Rn01_00100740 predicted 222
10 SASI_Rn01_00100741 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009437 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120767 predicted 710
2 SASI_Mm01_00120768 predicted 582
3 SASI_Mm01_00120769 predicted 512
4 SASI_Mm01_00120770 predicted 296
5 SASI_Mm01_00120771 predicted 305
6 SASI_Mm01_00120772 predicted 678
7 SASI_Mm01_00120774 predicted 796
8 SASI_Mm01_00120775 predicted 656
9 SASI_Mm01_00120776 predicted 529
10 SASI_Mm02_00316137 predicted 327
11 SASI_Mm01_00120773 predicted 215
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009437
VALIDATED
TST MISSION shRNA Bacterial Glycerol Stock
thiosulfate sulfurtransferase (rhodanese)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009437.2-966s1c1
Sequence:CCGGGCCCACCCAATCCAGCCAGTTCTCGAGAACTGGCTGGATTGGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009437.2-413s1c1
Sequence:CCGGCCGCACAGTGTCAGTGCTCAACTCGAGTTGAGCACTGACACTGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009437.2-554s1c1
Sequence:CCGGCCTAGAGAATCTCCAGTCTAACTCGAGTTAGACTGGAGATTCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009437.2-220s1c1
Sequence:CCGGCCTTCTTTGATATAGAGGAATCTCGAGATTCCTCTATATCAAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009437.4-389s21c1
Sequence:CCGGCCGCACAGTGTCAGTGCTCAACTCGAGTTGAGCACTGACACTGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009437.4-597s21c1
Sequence:CCGGACACAACCGGAGCCGGATATACTCGAGTATATCCGGCTCCGGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009437.4-942s21c1
Sequence:CCGGGCCCACCCAATCCAGCCAGTTCTCGAGAACTGGCTGGATTGGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009437.4-530s21c1
Sequence:CCGGCCTAGAGAATCTCCAGTCTAACTCGAGTTAGACTGGAGATTCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009437
VALIDATED
TST MISSION shRNA shRNA Plasmid DNA
thiosulfate sulfurtransferase (rhodanese)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009437.2-966s1c1
Sequence:CCGGGCCCACCCAATCCAGCCAGTTCTCGAGAACTGGCTGGATTGGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009437.2-413s1c1
Sequence:CCGGCCGCACAGTGTCAGTGCTCAACTCGAGTTGAGCACTGACACTGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009437.2-554s1c1
Sequence:CCGGCCTAGAGAATCTCCAGTCTAACTCGAGTTAGACTGGAGATTCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009437.2-220s1c1
Sequence:CCGGCCTTCTTTGATATAGAGGAATCTCGAGATTCCTCTATATCAAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009437.4-389s21c1
Sequence:CCGGCCGCACAGTGTCAGTGCTCAACTCGAGTTGAGCACTGACACTGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009437.4-597s21c1
Sequence:CCGGACACAACCGGAGCCGGATATACTCGAGTATATCCGGCTCCGGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009437.4-942s21c1
Sequence:CCGGGCCCACCCAATCCAGCCAGTTCTCGAGAACTGGCTGGATTGGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009437.4-530s21c1
Sequence:CCGGCCTAGAGAATCTCCAGTCTAACTCGAGTTAGACTGGAGATTCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009437
VALIDATED
TST MISSION shRNA Lentiviral Transduction Particles
thiosulfate sulfurtransferase (rhodanese)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009437.2-966s1c1
Sequence:CCGGGCCCACCCAATCCAGCCAGTTCTCGAGAACTGGCTGGATTGGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009437.2-413s1c1
Sequence:CCGGCCGCACAGTGTCAGTGCTCAACTCGAGTTGAGCACTGACACTGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009437.2-554s1c1
Sequence:CCGGCCTAGAGAATCTCCAGTCTAACTCGAGTTAGACTGGAGATTCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009437.2-220s1c1
Sequence:CCGGCCTTCTTTGATATAGAGGAATCTCGAGATTCCTCTATATCAAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009437.4-389s21c1
Sequence:CCGGCCGCACAGTGTCAGTGCTCAACTCGAGTTGAGCACTGACACTGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009437.4-597s21c1
Sequence:CCGGACACAACCGGAGCCGGATATACTCGAGTATATCCGGCTCCGGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009437.4-942s21c1
Sequence:CCGGGCCCACCCAATCCAGCCAGTTCTCGAGAACTGGCTGGATTGGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009437.4-530s21c1
Sequence:CCGGCCTAGAGAATCTCCAGTCTAACTCGAGTTAGACTGGAGATTCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003312
VALIDATED
TST MISSION shRNA Bacterial Glycerol Stock
thiosulfate sulfurtransferase (rhodanese)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003312.4-238s1c1
Sequence:CCGGGCCTCTTTCTTTGACATAGAACTCGAGTTCTATGTCAAAGAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003312.4-582s1c1
Sequence:CCGGGAACCTTGAATCTAAGAGGTTCTCGAGAACCTCTTAGATTCAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003312.4-409s1c1
Sequence:CCGGTGGTGGATGTTCCGTGTGTTTCTCGAGAAACACACGGAACATCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003312.4-607s1c1
Sequence:CCGGCTGGTGGATTCAAGGTCTCAACTCGAGTTGAGACCTTGAATCCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003312.4-693s1c1
Sequence:CCGGTGCCGTCAACATGCCTTTCATCTCGAGATGAAAGGCATGTTGACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003312.4-409s21c1
Sequence:CCGGTGGTGGATGTTCCGTGTGTTTCTCGAGAAACACACGGAACATCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003312.4-693s21c1
Sequence:CCGGTGCCGTCAACATGCCTTTCATCTCGAGATGAAAGGCATGTTGACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003312.4-607s21c1
Sequence:CCGGCTGGTGGATTCAAGGTCTCAACTCGAGTTGAGACCTTGAATCCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003312.4-973s21c1
Sequence:CCGGACCTCTTCTGCTTACTGTAACCTCGAGGTTACAGTAAGCAGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003312.4-437s21c1
Sequence:CCGGGCACCGTATCAGTGCTCAATGCTCGAGCATTGAGCACTGATACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003312
VALIDATED
TST MISSION shRNA shRNA Plasmid DNA
thiosulfate sulfurtransferase (rhodanese)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003312.4-238s1c1
Sequence:CCGGGCCTCTTTCTTTGACATAGAACTCGAGTTCTATGTCAAAGAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003312.4-582s1c1
Sequence:CCGGGAACCTTGAATCTAAGAGGTTCTCGAGAACCTCTTAGATTCAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003312.4-409s1c1
Sequence:CCGGTGGTGGATGTTCCGTGTGTTTCTCGAGAAACACACGGAACATCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003312.4-607s1c1
Sequence:CCGGCTGGTGGATTCAAGGTCTCAACTCGAGTTGAGACCTTGAATCCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003312.4-693s1c1
Sequence:CCGGTGCCGTCAACATGCCTTTCATCTCGAGATGAAAGGCATGTTGACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003312.4-409s21c1
Sequence:CCGGTGGTGGATGTTCCGTGTGTTTCTCGAGAAACACACGGAACATCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003312.4-693s21c1
Sequence:CCGGTGCCGTCAACATGCCTTTCATCTCGAGATGAAAGGCATGTTGACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003312.4-607s21c1
Sequence:CCGGCTGGTGGATTCAAGGTCTCAACTCGAGTTGAGACCTTGAATCCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003312.4-973s21c1
Sequence:CCGGACCTCTTCTGCTTACTGTAACCTCGAGGTTACAGTAAGCAGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003312.4-437s21c1
Sequence:CCGGGCACCGTATCAGTGCTCAATGCTCGAGCATTGAGCACTGATACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003312
VALIDATED
TST MISSION shRNA Lentiviral Transduction Particles
thiosulfate sulfurtransferase (rhodanese)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003312.4-238s1c1
Sequence:CCGGGCCTCTTTCTTTGACATAGAACTCGAGTTCTATGTCAAAGAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003312.4-582s1c1
Sequence:CCGGGAACCTTGAATCTAAGAGGTTCTCGAGAACCTCTTAGATTCAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003312.4-409s1c1
Sequence:CCGGTGGTGGATGTTCCGTGTGTTTCTCGAGAAACACACGGAACATCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003312.4-607s1c1
Sequence:CCGGCTGGTGGATTCAAGGTCTCAACTCGAGTTGAGACCTTGAATCCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003312.4-693s1c1
Sequence:CCGGTGCCGTCAACATGCCTTTCATCTCGAGATGAAAGGCATGTTGACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003312.4-409s21c1
Sequence:CCGGTGGTGGATGTTCCGTGTGTTTCTCGAGAAACACACGGAACATCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003312.4-693s21c1
Sequence:CCGGTGCCGTCAACATGCCTTTCATCTCGAGATGAAAGGCATGTTGACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003312.4-607s21c1
Sequence:CCGGCTGGTGGATTCAAGGTCTCAACTCGAGTTGAGACCTTGAATCCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003312.4-973s21c1
Sequence:CCGGACCTCTTCTGCTTACTGTAACCTCGAGGTTACAGTAAGCAGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003312.4-437s21c1
Sequence:CCGGGCACCGTATCAGTGCTCAATGCTCGAGCATTGAGCACTGATACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks