EMAIL THIS PAGE TO A FRIEND

TSTA3

tissue specific transplantation antigen P35B

Synonyms: FX P35B SDR4E1
UniProtKB ID: Q13630, B2R8Y7, D3DWK5, Q567Q9, Q9UDG7
Gene ID:
Human(7264) Summary: Tissue specific transplantation antigen P35B is a NADP(H)-binding protein. It catalyze the two-step epimerase and the reductase reactions in GDP-D-mannose metabolism, converting GDP-4-keto-6-D-deoxymannose to GDP-L-fucose. GDP-L-fucose is the substrate of several fucosyltransferases involved in the expression of many glycoconjugates, including blood group ABH antigens and developmental adhesion antigens. Mutations in this gene may cause leukocyte adhesion deficiency, type II. [provided by RefSeq, Jul 2008]
Mouse(22122) tissue specific transplantation antigen P35B
Rat(300036) tissue specific transplantation antigen P35B
Zebrafish(494077) tissue specific transplantation antigen P35B
chicken(420292) tissue specific transplantation antigen P35B
Horse(100063484) tissue specific transplantation antigen P35B
domestic cat(101099433) tissue specific transplantation antigen P35B
dog(475116) tissue specific transplantation antigen P35B
domestic guinea pig(100733475) tissue specific transplantation antigen P35B
naked mole-rat(101718494) tissue specific transplantation antigen P35B
cow(513158) tissue specific transplantation antigen P35B
sheep(101114115) tissue specific transplantation antigen P35B
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031201 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031201 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031201 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003313 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003313 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003313 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003313 Rosetta Predictions human pricing
NM_001127455 Rosetta Predictions rat pricing
NM_031201 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003313 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156781 predicted 862
2 SASI_Hs01_00156782 predicted 407
3 SASI_Hs02_00335434 predicted 266
4 SASI_Hs01_00156783 predicted 922
5 SASI_Hs01_00156784 predicted 519
6 SASI_Hs01_00156785 predicted 844
7 SASI_Hs01_00156786 predicted 892
8 SASI_Hs01_00156788 predicted 233
9 SASI_Hs01_00156789 predicted 962
10 SASI_Hs01_00156790 predicted 419
11 SASI_Hs01_00156787 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127455 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253793 predicted 303
2 SASI_Rn02_00253794 predicted 403
3 SASI_Rn02_00253795 predicted 240
4 SASI_Rn02_00253796 predicted 910
5 SASI_Rn02_00253797 predicted 642
6 SASI_Rn02_00253798 predicted 709
7 SASI_Rn02_00253799 predicted 403
8 SASI_Rn02_00253800 predicted 475
9 SASI_Rn02_00253801 predicted 238
10 SASI_Rn02_00253802 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031201 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021904 predicted 456
2 SASI_Mm01_00021905 predicted 803
3 SASI_Mm01_00021906 predicted 505
4 SASI_Mm01_00021907 predicted 333
5 SASI_Mm01_00021908 predicted 602
6 SASI_Mm01_00021909 predicted 288
7 SASI_Mm01_00021910 predicted 965
8 SASI_Mm01_00021911 predicted 570
9 SASI_Mm01_00021912 predicted 725
10 SASI_Mm01_00021913 predicted 445
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031201
VALIDATED
TSTA3 MISSION shRNA Bacterial Glycerol Stock
tissue specific transplantation antigen P35B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031201.1-1017s21c1
Sequence:CCGGCACTTGGTTCACCGACAACTACTCGAGTAGTTGTCGGTGAACCAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031201.1-321s21c1
Sequence:CCGGCCGGAATATCAAATACAACTTCTCGAGAAGTTGTATTTGATATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031201.1-911s21c1
Sequence:CCGGCAAAGTCAGATGGGCAATATACTCGAGTATATTGCCCATCTGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031201.1-602s21c1
Sequence:CCGGCCAATGTCTTTGGGCCTTATGCTCGAGCATAAGGCCCAAAGACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031201.1-1119s21c1
Sequence:CCGGCGCCAAGAACTGAGGACAGTACTCGAGTACTGTCCTCAGTTCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031201.1-458s1c1
Sequence:CCGGCCTATCCTATTGACGAGACAACTCGAGTTGTCTCGTCAATAGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031201.1-321s1c1
Sequence:CCGGCCGGAATATCAAATACAACTTCTCGAGAAGTTGTATTTGATATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031201.1-911s1c1
Sequence:CCGGCAAAGTCAGATGGGCAATATACTCGAGTATATTGCCCATCTGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031201.1-503s1c1
Sequence:CCGGGCAGCAATTTCGGGTACTCATCTCGAGATGAGTACCCGAAATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031201.1-1017s1c1
Sequence:CCGGCACTTGGTTCACCGACAACTACTCGAGTAGTTGTCGGTGAACCAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031201
VALIDATED
TSTA3 MISSION shRNA shRNA Plasmid DNA
tissue specific transplantation antigen P35B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031201.1-1017s21c1
Sequence:CCGGCACTTGGTTCACCGACAACTACTCGAGTAGTTGTCGGTGAACCAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031201.1-321s21c1
Sequence:CCGGCCGGAATATCAAATACAACTTCTCGAGAAGTTGTATTTGATATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031201.1-911s21c1
Sequence:CCGGCAAAGTCAGATGGGCAATATACTCGAGTATATTGCCCATCTGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031201.1-602s21c1
Sequence:CCGGCCAATGTCTTTGGGCCTTATGCTCGAGCATAAGGCCCAAAGACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031201.1-1119s21c1
Sequence:CCGGCGCCAAGAACTGAGGACAGTACTCGAGTACTGTCCTCAGTTCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031201.1-458s1c1
Sequence:CCGGCCTATCCTATTGACGAGACAACTCGAGTTGTCTCGTCAATAGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031201.1-321s1c1
Sequence:CCGGCCGGAATATCAAATACAACTTCTCGAGAAGTTGTATTTGATATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031201.1-911s1c1
Sequence:CCGGCAAAGTCAGATGGGCAATATACTCGAGTATATTGCCCATCTGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031201.1-503s1c1
Sequence:CCGGGCAGCAATTTCGGGTACTCATCTCGAGATGAGTACCCGAAATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031201.1-1017s1c1
Sequence:CCGGCACTTGGTTCACCGACAACTACTCGAGTAGTTGTCGGTGAACCAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031201
VALIDATED
TSTA3 MISSION shRNA Lentiviral Transduction Particles
tissue specific transplantation antigen P35B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031201.1-1017s21c1
Sequence:CCGGCACTTGGTTCACCGACAACTACTCGAGTAGTTGTCGGTGAACCAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031201.1-321s21c1
Sequence:CCGGCCGGAATATCAAATACAACTTCTCGAGAAGTTGTATTTGATATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031201.1-911s21c1
Sequence:CCGGCAAAGTCAGATGGGCAATATACTCGAGTATATTGCCCATCTGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031201.1-602s21c1
Sequence:CCGGCCAATGTCTTTGGGCCTTATGCTCGAGCATAAGGCCCAAAGACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031201.1-1119s21c1
Sequence:CCGGCGCCAAGAACTGAGGACAGTACTCGAGTACTGTCCTCAGTTCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031201.1-458s1c1
Sequence:CCGGCCTATCCTATTGACGAGACAACTCGAGTTGTCTCGTCAATAGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031201.1-321s1c1
Sequence:CCGGCCGGAATATCAAATACAACTTCTCGAGAAGTTGTATTTGATATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031201.1-911s1c1
Sequence:CCGGCAAAGTCAGATGGGCAATATACTCGAGTATATTGCCCATCTGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031201.1-503s1c1
Sequence:CCGGGCAGCAATTTCGGGTACTCATCTCGAGATGAGTACCCGAAATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031201.1-1017s1c1
Sequence:CCGGCACTTGGTTCACCGACAACTACTCGAGTAGTTGTCGGTGAACCAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003313
VALIDATED
TSTA3 MISSION shRNA Bacterial Glycerol Stock
tissue specific transplantation antigen P35B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003313.3-330s21c1
Sequence:CCGGTCCGGAATATCAAATACAATTCTCGAGAATTGTATTTGATATTCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303411    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003313.3-1067s21c1
Sequence:CCGGAGCTGGAAGACAGGATCAGGTCTCGAGACCTGATCCTGTCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003313.3-788s21c1
Sequence:CCGGGTCCTGCGGGAGTACAATGAACTCGAGTTCATTGTACTCCCGCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003313.3-735s21c1
Sequence:CCGGATCCGCGGAGGCAGTTCATATCTCGAGATATGAACTGCCTCCGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003313.3-200s21c1
Sequence:CCGGCCTGGAGAGGACTGGGTGTTTCTCGAGAAACACCCAGTCCTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003313.2-574s1c1
Sequence:CCGGCCACGACAACTTCAACATCGACTCGAGTCGATGTTGAAGTTGTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003313.2-418s1c1
Sequence:CCGGCCCGATAGATGAGACCATGATCTCGAGATCATGGTCTCATCTATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003313.2-883s1c1
Sequence:CCGGGTTTAAGAAGACAGCCAGTAACTCGAGTTACTGGCTGTCTTCTTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003313.2-146s1c1
Sequence:CCGGCCTGGAGAGGACTGGGTGTTTCTCGAGAAACACCCAGTCCTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003313.2-472s1c1
Sequence:CCGGGTACTCGTATGCCAAGAGGATCTCGAGATCCTCTTGGCATACGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003313
VALIDATED
TSTA3 MISSION shRNA shRNA Plasmid DNA
tissue specific transplantation antigen P35B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003313.3-330s21c1
Sequence:CCGGTCCGGAATATCAAATACAATTCTCGAGAATTGTATTTGATATTCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303411    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003313.3-1067s21c1
Sequence:CCGGAGCTGGAAGACAGGATCAGGTCTCGAGACCTGATCCTGTCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003313.3-788s21c1
Sequence:CCGGGTCCTGCGGGAGTACAATGAACTCGAGTTCATTGTACTCCCGCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003313.3-735s21c1
Sequence:CCGGATCCGCGGAGGCAGTTCATATCTCGAGATATGAACTGCCTCCGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003313.3-200s21c1
Sequence:CCGGCCTGGAGAGGACTGGGTGTTTCTCGAGAAACACCCAGTCCTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003313.2-574s1c1
Sequence:CCGGCCACGACAACTTCAACATCGACTCGAGTCGATGTTGAAGTTGTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003313.2-418s1c1
Sequence:CCGGCCCGATAGATGAGACCATGATCTCGAGATCATGGTCTCATCTATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003313.2-883s1c1
Sequence:CCGGGTTTAAGAAGACAGCCAGTAACTCGAGTTACTGGCTGTCTTCTTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003313.2-146s1c1
Sequence:CCGGCCTGGAGAGGACTGGGTGTTTCTCGAGAAACACCCAGTCCTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003313.2-472s1c1
Sequence:CCGGGTACTCGTATGCCAAGAGGATCTCGAGATCCTCTTGGCATACGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003313
VALIDATED
TSTA3 MISSION shRNA Lentiviral Transduction Particles
tissue specific transplantation antigen P35B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003313.3-330s21c1
Sequence:CCGGTCCGGAATATCAAATACAATTCTCGAGAATTGTATTTGATATTCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303411    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003313.3-1067s21c1
Sequence:CCGGAGCTGGAAGACAGGATCAGGTCTCGAGACCTGATCCTGTCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003313.3-788s21c1
Sequence:CCGGGTCCTGCGGGAGTACAATGAACTCGAGTTCATTGTACTCCCGCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003313.3-735s21c1
Sequence:CCGGATCCGCGGAGGCAGTTCATATCTCGAGATATGAACTGCCTCCGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003313.3-200s21c1
Sequence:CCGGCCTGGAGAGGACTGGGTGTTTCTCGAGAAACACCCAGTCCTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003313.2-574s1c1
Sequence:CCGGCCACGACAACTTCAACATCGACTCGAGTCGATGTTGAAGTTGTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003313.2-418s1c1
Sequence:CCGGCCCGATAGATGAGACCATGATCTCGAGATCATGGTCTCATCTATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003313.2-883s1c1
Sequence:CCGGGTTTAAGAAGACAGCCAGTAACTCGAGTTACTGGCTGTCTTCTTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003313.2-146s1c1
Sequence:CCGGCCTGGAGAGGACTGGGTGTTTCTCGAGAAACACCCAGTCCTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003313.2-472s1c1
Sequence:CCGGGTACTCGTATGCCAAGAGGATCTCGAGATCCTCTTGGCATACGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks