EMAIL THIS PAGE TO A FRIEND

TSTD1

thiosulfate sulfurtransferase (rhodanese)-like domain containing 1

Synonyms: KAT
Gene ID:
Mouse(226654) thiosulfate sulfurtransferase (rhodanese)-like domain containing 1
Rat(100359478) thiosulfate sulfurtransferase (rhodanese)-like domain containing 1
cow(615465) thiosulfate sulfurtransferase (rhodanese)-like domain containing 1
sheep(101122649) thiosulfate sulfurtransferase (rhodanese)-like domain containing 1
naked mole-rat(101711848) thiosulfate sulfurtransferase (rhodanese)-like domain containing 1
domestic guinea pig(100727018) thiosulfate sulfurtransferase (rhodanese)-like domain containing 1
dog(488645) thiosulfate sulfurtransferase (rhodanese)-like domain containing 1
domestic cat(101088810) thiosulfate sulfurtransferase (rhodanese)-like domain containing 1
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001164525 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001164525 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001164525 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001126312 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001126312 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001126312 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU229761 MISSION® esiRNA esiRNA targeting human TSTD1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001126312 Rosetta Predictions human pricing
XM_129558 Rosetta Predictions mouse pricing
XM_917811 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328407 predicted 264
2 SASI_Hs02_00328408 predicted 307
3 SASI_Hs02_00328409 predicted 304
4 SASI_Hs02_00328410 predicted 368
5 SASI_Hs02_00328411 predicted 368
6 SASI_Hs02_00328412 predicted 274
7 SASI_Hs02_00328413 predicted 215
8 SASI_Hs02_00328414 predicted 237
9 SASI_Hs02_00328415 predicted 221
10 SASI_Hs02_00328416 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129558 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00228229 predicted 267
2 SASI_Mm01_00228231 predicted 285
3 SASI_Mm01_00228233 predicted 212
4 SASI_Mm01_00228234 predicted 218
5 SASI_Mm01_00228235 predicted 295
6 SASI_Mm01_00228238 predicted 268
7 SASI_Mm02_00424309 predicted 291
8 SASI_Mm02_00424310 predicted 219
9 SASI_Mm01_00228230 predicted 293
10 SASI_Mm01_00228232 predicted 292
11 SASI_Mm01_00228236 predicted 292
12 SASI_Mm01_00228237 predicted 292
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_917811 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00441425 predicted 271
2 SASI_Mm02_00441426 predicted 292
3 SASI_Mm02_00441427 predicted 211
4 SASI_Mm02_00441428 predicted 218
5 SASI_Mm02_00441429 predicted 288
6 SASI_Mm02_00441430 predicted 266
7 SASI_Mm02_00441431 predicted 285
8 SASI_Mm02_00441432 predicted 220
9 SASI_Mm02_00441433 predicted 293
10 SASI_Mm02_00441434 predicted 294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001164525
TSTD1 MISSION shRNA Bacterial Glycerol Stock
thiosulfate sulfurtransferase (rhodanese)-like domain containing 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000377189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164525.1-115s21c1
Sequence:CCGGTCCTTCTCTGAGCTCCGTTCACTCGAGTGAACGGAGCTCAGAGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164525.1-300s21c1
Sequence:CCGGGCTAGAAGACAAGAATCTTATCTCGAGATAAGATTCTTGTCTTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164525.1-222s21c1
Sequence:CCGGCCCTGTGTCTGAATTGGAAATCTCGAGATTTCCAATTCAGACACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164525.1-365s21c1
Sequence:CCGGTGGCACAAGGTCTTGGCTATACTCGAGTATAGCCAAGACCTTGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001164525
TSTD1 MISSION shRNA shRNA Plasmid DNA
thiosulfate sulfurtransferase (rhodanese)-like domain containing 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000377189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164525.1-115s21c1
Sequence:CCGGTCCTTCTCTGAGCTCCGTTCACTCGAGTGAACGGAGCTCAGAGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164525.1-300s21c1
Sequence:CCGGGCTAGAAGACAAGAATCTTATCTCGAGATAAGATTCTTGTCTTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164525.1-222s21c1
Sequence:CCGGCCCTGTGTCTGAATTGGAAATCTCGAGATTTCCAATTCAGACACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164525.1-365s21c1
Sequence:CCGGTGGCACAAGGTCTTGGCTATACTCGAGTATAGCCAAGACCTTGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001164525
TSTD1 MISSION shRNA Lentiviral Transduction Particles
thiosulfate sulfurtransferase (rhodanese)-like domain containing 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000377189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164525.1-115s21c1
Sequence:CCGGTCCTTCTCTGAGCTCCGTTCACTCGAGTGAACGGAGCTCAGAGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164525.1-300s21c1
Sequence:CCGGGCTAGAAGACAAGAATCTTATCTCGAGATAAGATTCTTGTCTTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164525.1-222s21c1
Sequence:CCGGCCCTGTGTCTGAATTGGAAATCTCGAGATTTCCAATTCAGACACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164525.1-365s21c1
Sequence:CCGGTGGCACAAGGTCTTGGCTATACTCGAGTATAGCCAAGACCTTGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001126312
TSTD1 MISSION shRNA Bacterial Glycerol Stock
thiosulfate sulfurtransferase (rhodanese)-like domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126312.1-404s21c1
Sequence:CCGGCAACTACGCTGGAGCCTATAGCTCGAGCTATAGGCTCCAGCGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126312.1-242s21c1
Sequence:CCGGGTTGGAGAGTGCTCTGCAGATCTCGAGATCTGCAGAGCACTCTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126312.1-310s21c1
Sequence:CCGGTGGAAGATGAGCATCTCGTTTCTCGAGAAACGAGATGCTCATCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126312.1-270s21c1
Sequence:CCGGGCTGCCTTCCAGGCTTTATATCTCGAGATATAAAGCCTGGAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126312.1-123s21c1
Sequence:CCGGTCGCTTCCTGAACTCCGTTCACTCGAGTGAACGGAGTTCAGGAAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001126312
TSTD1 MISSION shRNA shRNA Plasmid DNA
thiosulfate sulfurtransferase (rhodanese)-like domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126312.1-404s21c1
Sequence:CCGGCAACTACGCTGGAGCCTATAGCTCGAGCTATAGGCTCCAGCGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126312.1-242s21c1
Sequence:CCGGGTTGGAGAGTGCTCTGCAGATCTCGAGATCTGCAGAGCACTCTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126312.1-310s21c1
Sequence:CCGGTGGAAGATGAGCATCTCGTTTCTCGAGAAACGAGATGCTCATCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126312.1-270s21c1
Sequence:CCGGGCTGCCTTCCAGGCTTTATATCTCGAGATATAAAGCCTGGAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126312.1-123s21c1
Sequence:CCGGTCGCTTCCTGAACTCCGTTCACTCGAGTGAACGGAGTTCAGGAAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001126312
TSTD1 MISSION shRNA Lentiviral Transduction Particles
thiosulfate sulfurtransferase (rhodanese)-like domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126312.1-404s21c1
Sequence:CCGGCAACTACGCTGGAGCCTATAGCTCGAGCTATAGGCTCCAGCGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126312.1-242s21c1
Sequence:CCGGGTTGGAGAGTGCTCTGCAGATCTCGAGATCTGCAGAGCACTCTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126312.1-310s21c1
Sequence:CCGGTGGAAGATGAGCATCTCGTTTCTCGAGAAACGAGATGCTCATCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126312.1-270s21c1
Sequence:CCGGGCTGCCTTCCAGGCTTTATATCTCGAGATATAAAGCCTGGAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126312.1-123s21c1
Sequence:CCGGTCGCTTCCTGAACTCCGTTCACTCGAGTGAACGGAGTTCAGGAAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks