EMAIL THIS PAGE TO A FRIEND

TSTD2

thiosulfate sulfurtransferase (rhodanese)-like domain containing 2

Synonyms: C9orf97
Gene ID:
Mouse(272027) thiosulfate sulfurtransferase (rhodanese)-like domain containing 2
Rat(362514) thiosulfate sulfurtransferase (rhodanese)-like domain containing 2
chicken(427380) thiosulfate sulfurtransferase (rhodanese)-like domain containing 2
domestic cat(101091567) thiosulfate sulfurtransferase (rhodanese)-like domain containing 2
Horse(100064552) thiosulfate sulfurtransferase (rhodanese)-like domain containing 2
dog(481622) thiosulfate sulfurtransferase (rhodanese)-like domain containing 2
domestic guinea pig(100735283) thiosulfate sulfurtransferase (rhodanese)-like domain containing 2
naked mole-rat(101697334) thiosulfate sulfurtransferase (rhodanese)-like domain containing 2
Domestic Rabbit(100348871) thiosulfate sulfurtransferase (rhodanese)-like domain containing 2
cow(616726) thiosulfate sulfurtransferase (rhodanese)-like domain containing 2
sheep(101104459) thiosulfate sulfurtransferase (rhodanese)-like domain containing 2
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139246 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139246 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139246 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173033 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173033 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173033 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139246 Rosetta Predictions human pricing
NM_001108663 Rosetta Predictions rat pricing
NM_173033 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139246 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194503 predicted 1391
2 SASI_Hs01_00194504 predicted 962
3 SASI_Hs01_00194505 predicted 672
4 SASI_Hs02_00364250 predicted 567
5 SASI_Hs01_00194507 predicted 1130
6 SASI_Hs01_00194508 predicted 834
7 SASI_Hs01_00194510 predicted 747
8 SASI_Hs01_00194511 predicted 1887
9 SASI_Hs01_00194512 predicted 1380
10 SASI_Hs02_00364251 predicted 1308
11 SASI_Hs01_00194506 predicted 237
12 SASI_Hs01_00194509 predicted 1413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108663 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240845 predicted 1470
2 SASI_Rn02_00240846 predicted 355
3 SASI_Rn02_00240847 predicted 1501
4 SASI_Rn02_00240848 predicted 1380
5 SASI_Rn02_00240849 predicted 428
6 SASI_Rn02_00240850 predicted 341
7 SASI_Rn02_00240851 predicted 1578
8 SASI_Rn02_00240852 predicted 441
9 SASI_Rn02_00240853 predicted 1573
10 SASI_Rn02_00240854 predicted 1537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173033 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083706 predicted 533
2 SASI_Mm01_00083707 predicted 338
3 SASI_Mm01_00083708 predicted 789
4 SASI_Mm02_00345101 predicted 436
5 SASI_Mm01_00083711 predicted 1252
6 SASI_Mm01_00083712 predicted 1369
7 SASI_Mm02_00345102 predicted 811
8 SASI_Mm01_00083714 predicted 324
9 SASI_Mm01_00083715 predicted 1455
10 SASI_Mm02_00345103 predicted 1487
11 SASI_Mm01_00083709 predicted 1306
12 SASI_Mm01_00083710 predicted 1302
13 SASI_Mm01_00083713 predicted 977
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139246
TSTD2 MISSION shRNA Bacterial Glycerol Stock
thiosulfate sulfurtransferase (rhodanese)-like domain containing 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139246.4-1248s21c1
Sequence:CCGGGAATTGCGTGTTGGTGTATTTCTCGAGAAATACACCAACACGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139246.4-1081s21c1
Sequence:CCGGTCACAGGCAAGATTCGAATTGCTCGAGCAATTCGAATCTTGCCTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139246.3-579s1c1
Sequence:CCGGCCCTGATATAAGCTGCTTTAACTCGAGTTAAAGCAGCTTATATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139246.3-1541s1c1
Sequence:CCGGGCCCTATGCAAGACAGCTTTACTCGAGTAAAGCTGTCTTGCATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139246.3-1053s1c1
Sequence:CCGGCCTTCTTGATTGCAGAAACTTCTCGAGAAGTTTCTGCAATCAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139246.3-251s1c1
Sequence:CCGGCAGAATTAGATGGCAGTACAACTCGAGTTGTACTGCCATCTAATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139246.3-425s1c1
Sequence:CCGGCAACACAACATGCTGATGAAACTCGAGTTTCATCAGCATGTTGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139246
TSTD2 MISSION shRNA shRNA Plasmid DNA
thiosulfate sulfurtransferase (rhodanese)-like domain containing 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139246.4-1248s21c1
Sequence:CCGGGAATTGCGTGTTGGTGTATTTCTCGAGAAATACACCAACACGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139246.4-1081s21c1
Sequence:CCGGTCACAGGCAAGATTCGAATTGCTCGAGCAATTCGAATCTTGCCTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139246.3-579s1c1
Sequence:CCGGCCCTGATATAAGCTGCTTTAACTCGAGTTAAAGCAGCTTATATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139246.3-1541s1c1
Sequence:CCGGGCCCTATGCAAGACAGCTTTACTCGAGTAAAGCTGTCTTGCATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139246.3-1053s1c1
Sequence:CCGGCCTTCTTGATTGCAGAAACTTCTCGAGAAGTTTCTGCAATCAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139246.3-251s1c1
Sequence:CCGGCAGAATTAGATGGCAGTACAACTCGAGTTGTACTGCCATCTAATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139246.3-425s1c1
Sequence:CCGGCAACACAACATGCTGATGAAACTCGAGTTTCATCAGCATGTTGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139246
TSTD2 MISSION shRNA Lentiviral Transduction Particles
thiosulfate sulfurtransferase (rhodanese)-like domain containing 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139246.4-1248s21c1
Sequence:CCGGGAATTGCGTGTTGGTGTATTTCTCGAGAAATACACCAACACGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139246.4-1081s21c1
Sequence:CCGGTCACAGGCAAGATTCGAATTGCTCGAGCAATTCGAATCTTGCCTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139246.3-579s1c1
Sequence:CCGGCCCTGATATAAGCTGCTTTAACTCGAGTTAAAGCAGCTTATATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139246.3-1541s1c1
Sequence:CCGGGCCCTATGCAAGACAGCTTTACTCGAGTAAAGCTGTCTTGCATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139246.3-1053s1c1
Sequence:CCGGCCTTCTTGATTGCAGAAACTTCTCGAGAAGTTTCTGCAATCAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139246.3-251s1c1
Sequence:CCGGCAGAATTAGATGGCAGTACAACTCGAGTTGTACTGCCATCTAATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139246.3-425s1c1
Sequence:CCGGCAACACAACATGCTGATGAAACTCGAGTTTCATCAGCATGTTGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173033
TSTD2 MISSION shRNA Bacterial Glycerol Stock
thiosulfate sulfurtransferase (rhodanese)-like domain containing 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173033.3-814s1c1
Sequence:CCGGCATGCTTTCCTGCCCATTATTCTCGAGAATAATGGGCAGGAAAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173033.3-745s21c1
Sequence:CCGGGATTGCTACTGAAGGAATCAACTCGAGTTGATTCCTTCAGTAGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173033.3-1364s21c1
Sequence:CCGGGCCTACAACAGTTCTGTGGTACTCGAGTACCACAGAACTGTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173033.3-345s21c1
Sequence:CCGGCCTCTTATGAATTTAAGGGAACTCGAGTTCCCTTAAATTCATAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173033.3-755s21c1
Sequence:CCGGGAAGGAATCAATGGAACTGTTCTCGAGAACAGTTCCATTGATTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173033.2-1299s1c1
Sequence:CCGGGCCTACAACAGTTCTGTGGTACTCGAGTACCACAGAACTGTTGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173033.2-690s1c1
Sequence:CCGGGAAGGAATCAATGGAACTGTTCTCGAGAACAGTTCCATTGATTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173033.2-680s1c1
Sequence:CCGGGATTGCTACTGAAGGAATCAACTCGAGTTGATTCCTTCAGTAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173033.2-280s1c1
Sequence:CCGGCCTCTTATGAATTTAAGGGAACTCGAGTTCCCTTAAATTCATAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173033.2-848s1c1
Sequence:CCGGGTTTGAAGAGATCGTGCCTATCTCGAGATAGGCACGATCTCTTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197492    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173033.2-2076s1c1
Sequence:CCGGCGGCTTCAGAATCTAAAGTATCTCGAGATACTTTAGATTCTGAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173033
TSTD2 MISSION shRNA shRNA Plasmid DNA
thiosulfate sulfurtransferase (rhodanese)-like domain containing 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173033.3-814s1c1
Sequence:CCGGCATGCTTTCCTGCCCATTATTCTCGAGAATAATGGGCAGGAAAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173033.3-745s21c1
Sequence:CCGGGATTGCTACTGAAGGAATCAACTCGAGTTGATTCCTTCAGTAGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173033.3-1364s21c1
Sequence:CCGGGCCTACAACAGTTCTGTGGTACTCGAGTACCACAGAACTGTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173033.3-345s21c1
Sequence:CCGGCCTCTTATGAATTTAAGGGAACTCGAGTTCCCTTAAATTCATAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173033.3-755s21c1
Sequence:CCGGGAAGGAATCAATGGAACTGTTCTCGAGAACAGTTCCATTGATTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173033.2-1299s1c1
Sequence:CCGGGCCTACAACAGTTCTGTGGTACTCGAGTACCACAGAACTGTTGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173033.2-690s1c1
Sequence:CCGGGAAGGAATCAATGGAACTGTTCTCGAGAACAGTTCCATTGATTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173033.2-680s1c1
Sequence:CCGGGATTGCTACTGAAGGAATCAACTCGAGTTGATTCCTTCAGTAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173033.2-280s1c1
Sequence:CCGGCCTCTTATGAATTTAAGGGAACTCGAGTTCCCTTAAATTCATAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173033.2-848s1c1
Sequence:CCGGGTTTGAAGAGATCGTGCCTATCTCGAGATAGGCACGATCTCTTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197492    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173033.2-2076s1c1
Sequence:CCGGCGGCTTCAGAATCTAAAGTATCTCGAGATACTTTAGATTCTGAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173033
TSTD2 MISSION shRNA Lentiviral Transduction Particles
thiosulfate sulfurtransferase (rhodanese)-like domain containing 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173033.3-814s1c1
Sequence:CCGGCATGCTTTCCTGCCCATTATTCTCGAGAATAATGGGCAGGAAAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173033.3-745s21c1
Sequence:CCGGGATTGCTACTGAAGGAATCAACTCGAGTTGATTCCTTCAGTAGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173033.3-1364s21c1
Sequence:CCGGGCCTACAACAGTTCTGTGGTACTCGAGTACCACAGAACTGTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173033.3-345s21c1
Sequence:CCGGCCTCTTATGAATTTAAGGGAACTCGAGTTCCCTTAAATTCATAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173033.3-755s21c1
Sequence:CCGGGAAGGAATCAATGGAACTGTTCTCGAGAACAGTTCCATTGATTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173033.2-1299s1c1
Sequence:CCGGGCCTACAACAGTTCTGTGGTACTCGAGTACCACAGAACTGTTGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173033.2-690s1c1
Sequence:CCGGGAAGGAATCAATGGAACTGTTCTCGAGAACAGTTCCATTGATTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173033.2-680s1c1
Sequence:CCGGGATTGCTACTGAAGGAATCAACTCGAGTTGATTCCTTCAGTAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173033.2-280s1c1
Sequence:CCGGCCTCTTATGAATTTAAGGGAACTCGAGTTCCCTTAAATTCATAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173033.2-848s1c1
Sequence:CCGGGTTTGAAGAGATCGTGCCTATCTCGAGATAGGCACGATCTCTTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197492    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173033.2-2076s1c1
Sequence:CCGGCGGCTTCAGAATCTAAAGTATCTCGAGATACTTTAGATTCTGAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks