EMAIL THIS PAGE TO A FRIEND

TSTD3

thiosulfate sulfurtransferase (rhodanese)-like domain containing 3

UniProtKB ID: H0UI37
Gene ID:
Mouse(77032) thiosulfate sulfurtransferase (rhodanese)-like domain containing 3
Rat(500420) thiosulfate sulfurtransferase (rhodanese)-like domain containing 3
sheep(101102910) thiosulfate sulfurtransferase (rhodanese)-like domain containing 3
naked mole-rat(101698705) thiosulfate sulfurtransferase (rhodanese)-like domain containing 3
domestic cat(101087158) thiosulfate sulfurtransferase (rhodanese)-like domain containing 3
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029840 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029840 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029840 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU179011 MISSION® esiRNA esiRNA targeting mouse 2610029I01Rik mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001721168 Rosetta Predictions human pricing
XM_001721169 Rosetta Predictions human pricing
XM_001721586 Rosetta Predictions human pricing
XM_001721588 Rosetta Predictions human pricing
XM_001725821 Rosetta Predictions human pricing
XM_001725822 Rosetta Predictions human pricing
XM_001058924 Rosetta Predictions rat pricing
XM_575783 Rosetta Predictions rat pricing
XM_001474504 Rosetta Predictions mouse pricing
XM_001475329 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721168 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00441235 predicted 347
2 SASI_Hs02_00441236 predicted 285
3 SASI_Hs02_00441237 predicted 285
4 SASI_Hs02_00441238 predicted 258
5 SASI_Hs02_00441239 predicted 323
6 SASI_Hs02_00441240 predicted 309
7 SASI_Hs02_00441241 predicted 319
8 SASI_Hs02_00441242 predicted 359
9 SASI_Hs02_00441243 predicted 380
10 SASI_Hs02_00441244 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00441245 predicted 272
2 SASI_Hs02_00441246 predicted 524
3 SASI_Hs02_00441247 predicted 411
4 SASI_Hs02_00441248 predicted 443
5 SASI_Hs02_00441249 predicted 432
6 SASI_Hs02_00441250 predicted 342
7 SASI_Hs02_00441251 predicted 277
8 SASI_Hs02_00441252 predicted 411
9 SASI_Hs02_00441253 predicted 499
10 SASI_Hs02_00441254 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721586 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00443783 predicted 345
2 SASI_Hs02_00443784 predicted 291
3 SASI_Hs02_00443785 predicted 287
4 SASI_Hs02_00443786 predicted 260
5 SASI_Hs02_00443787 predicted 324
6 SASI_Hs02_00443788 predicted 313
7 SASI_Hs02_00443789 predicted 317
8 SASI_Hs02_00443790 predicted 363
9 SASI_Hs02_00443791 predicted 377
10 SASI_Hs02_00443792 predicted 279
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721588 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00443803 predicted 272
2 SASI_Hs02_00443804 predicted 528
3 SASI_Hs02_00443805 predicted 406
4 SASI_Hs02_00443806 predicted 439
5 SASI_Hs02_00443807 predicted 440
6 SASI_Hs02_00443808 predicted 340
7 SASI_Hs02_00443809 predicted 279
8 SASI_Hs02_00443810 predicted 405
9 SASI_Hs02_00443811 predicted 496
10 SASI_Hs02_00443812 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725821 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00470190 predicted 346
2 SASI_Hs02_00470191 predicted 288
3 SASI_Hs02_00470192 predicted 291
4 SASI_Hs02_00470193 predicted 265
5 SASI_Hs02_00470194 predicted 322
6 SASI_Hs02_00470195 predicted 312
7 SASI_Hs02_00470196 predicted 314
8 SASI_Hs02_00470197 predicted 361
9 SASI_Hs02_00470198 predicted 375
10 SASI_Hs02_00470199 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725822 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00470200 predicted 273
2 SASI_Hs02_00470201 predicted 525
3 SASI_Hs02_00470202 predicted 405
4 SASI_Hs02_00470203 predicted 437
5 SASI_Hs02_00470204 predicted 437
6 SASI_Hs02_00470205 predicted 333
7 SASI_Hs02_00470206 predicted 281
8 SASI_Hs02_00470207 predicted 410
9 SASI_Hs02_00470208 predicted 498
10 SASI_Hs02_00470209 predicted 336
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058924 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291283 predicted 917
2 SASI_Rn02_00291284 predicted 723
3 SASI_Rn02_00291285 predicted 759
4 SASI_Rn02_00291286 predicted 303
5 SASI_Rn02_00291287 predicted 914
6 SASI_Rn02_00291288 predicted 761
7 SASI_Rn02_00291289 predicted 691
8 SASI_Rn02_00291290 predicted 770
9 SASI_Rn02_00291291 predicted 635
10 SASI_Rn02_00291292 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575783 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404323 predicted 917
2 SASI_Rn02_00404324 predicted 753
3 SASI_Rn02_00404325 predicted 295
4 SASI_Rn02_00404326 predicted 918
5 SASI_Rn02_00404327 predicted 766
6 SASI_Rn02_00404328 predicted 690
7 SASI_Rn02_00404329 predicted 770
8 SASI_Rn02_00404330 predicted 635
9 SASI_Rn02_00404331 predicted 704
10 SASI_Rn02_00404332 predicted 843
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001474504 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00375837 predicted 684
2 SASI_Mm02_00375838 predicted 525
3 SASI_Mm02_00375839 predicted 443
4 SASI_Mm02_00375840 predicted 483
5 SASI_Mm02_00375841 predicted 441
6 SASI_Mm02_00375842 predicted 458
7 SASI_Mm02_00375843 predicted 485
8 SASI_Mm02_00375844 predicted 513
9 SASI_Mm02_00375845 predicted 399
10 SASI_Mm02_00375846 predicted 512
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001475329 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00381701 predicted 474
2 SASI_Mm02_00381702 predicted 682
3 SASI_Mm02_00381703 predicted 479
4 SASI_Mm02_00381704 predicted 518
5 SASI_Mm02_00381705 predicted 449
6 SASI_Mm02_00381706 predicted 448
7 SASI_Mm02_00381707 predicted 512
8 SASI_Mm02_00381708 predicted 460
9 SASI_Mm02_00381709 predicted 395
10 SASI_Mm02_00381710 predicted 509
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029840
VALIDATED
TSTD3 MISSION shRNA Bacterial Glycerol Stock
thiosulfate sulfurtransferase (rhodanese)-like domain containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029840.1-157s21c1
Sequence:CCGGTTGGCGGTTTGAAGTCAATATCTCGAGATATTGACTTCAAACCGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029840.1-310s21c1
Sequence:CCGGTACCTGGATCAATCAACATACCTCGAGGTATGTTGATTGATCCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029840.1-485s21c1
Sequence:CCGGCTTTAACAGTGCTCAACATTACTCGAGTAATGTTGAGCACTGTTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342146    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029840.1-581s21c1
Sequence:CCGGGACTCGGTGTTCATATCTATACTCGAGTATAGATATGAACACCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029840.1-215s21c1
Sequence:CCGGTGTGACTTATAGGGAACTAAACTCGAGTTTAGTTCCCTATAAGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029840
VALIDATED
TSTD3 MISSION shRNA shRNA Plasmid DNA
thiosulfate sulfurtransferase (rhodanese)-like domain containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029840.1-157s21c1
Sequence:CCGGTTGGCGGTTTGAAGTCAATATCTCGAGATATTGACTTCAAACCGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029840.1-310s21c1
Sequence:CCGGTACCTGGATCAATCAACATACCTCGAGGTATGTTGATTGATCCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029840.1-485s21c1
Sequence:CCGGCTTTAACAGTGCTCAACATTACTCGAGTAATGTTGAGCACTGTTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342146    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029840.1-581s21c1
Sequence:CCGGGACTCGGTGTTCATATCTATACTCGAGTATAGATATGAACACCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029840.1-215s21c1
Sequence:CCGGTGTGACTTATAGGGAACTAAACTCGAGTTTAGTTCCCTATAAGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029840
VALIDATED
TSTD3 MISSION shRNA Lentiviral Transduction Particles
thiosulfate sulfurtransferase (rhodanese)-like domain containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029840.1-157s21c1
Sequence:CCGGTTGGCGGTTTGAAGTCAATATCTCGAGATATTGACTTCAAACCGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029840.1-310s21c1
Sequence:CCGGTACCTGGATCAATCAACATACCTCGAGGTATGTTGATTGATCCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029840.1-485s21c1
Sequence:CCGGCTTTAACAGTGCTCAACATTACTCGAGTAATGTTGAGCACTGTTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342146    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029840.1-581s21c1
Sequence:CCGGGACTCGGTGTTCATATCTATACTCGAGTATAGATATGAACACCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029840.1-215s21c1
Sequence:CCGGTGTGACTTATAGGGAACTAAACTCGAGTTTAGTTCCCTATAAGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks