EMAIL THIS PAGE TO A FRIEND

TTBK1

tau tubulin kinase 1

Synonyms: BDTK
UniProtKB ID: Q5TCY1, A2A2U5, Q2L6C6, Q6ZNH0, Q8N444, Q96JH2
Gene ID:
Mouse(106763) tau tubulin kinase 1
Rat(316229) tau tubulin kinase 1
Zebrafish(100000353) tau tubulin kinase 1
domestic cat(101093857) tau tubulin kinase 1
Horse(100147091) tau tubulin kinase 1
chicken(416713) tau tubulin kinase 1
dog(100684678) tau tubulin kinase 1
cow(786439) tau tubulin kinase 1
sheep(101111916) tau tubulin kinase 1
domestic guinea pig(100715153) tau tubulin kinase 1
naked mole-rat(101717285) tau tubulin kinase 1
159 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032538 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032538 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032538 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175351 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175351 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175351 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_166453 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_166453 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_166453 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001162864 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001162864 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001162864 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032538 Rosetta Predictions human pricing
XM_001066190 Rosetta Predictions rat pricing
XM_244043 Rosetta Predictions rat pricing
NM_175351 Rosetta Predictions mouse pricing
XM_001476670 Rosetta Predictions mouse pricing
XM_001480065 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032538 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168418 predicted 1130
2 SASI_Hs01_00168419 predicted 938
3 SASI_Hs01_00168420 predicted 571
4 SASI_Hs01_00168421 predicted 572
5 SASI_Hs01_00168422 predicted 443
6 SASI_Hs01_00168423 predicted 3151
7 SASI_Hs01_00168424 predicted 1843
8 SASI_Hs01_00168425 predicted 776
9 SASI_Hs01_00168426 predicted 3088
10 SASI_Hs01_00168427 predicted 889
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066190 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00316578 predicted 998
2 SASI_Rn02_00316579 predicted 2724
3 SASI_Rn02_00316580 predicted 284
4 SASI_Rn02_00316581 predicted 853
5 SASI_Rn02_00316582 predicted 3067
6 SASI_Rn02_00316583 predicted 2759
7 SASI_Rn02_00316584 predicted 292
8 SASI_Rn02_00316585 predicted 1679
9 SASI_Rn02_00316586 predicted 1214
10 SASI_Rn02_00316587 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_244043 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391809 predicted 1003
2 SASI_Rn02_00391810 predicted 2725
3 SASI_Rn02_00391811 predicted 285
4 SASI_Rn02_00391812 predicted 852
5 SASI_Rn02_00391813 predicted 3072
6 SASI_Rn02_00391814 predicted 2759
7 SASI_Rn02_00391815 predicted 292
8 SASI_Rn02_00391816 predicted 1685
9 SASI_Rn02_00391817 predicted 1215
10 SASI_Rn02_00391818 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175351 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096855 predicted 1568
2 SASI_Mm01_00096856 predicted 1624
3 SASI_Mm01_00096857 predicted 1658
4 SASI_Mm01_00096858 predicted 1611
5 SASI_Mm01_00096859 predicted 1659
6 SASI_Mm01_00096860 predicted 1618
7 SASI_Mm01_00096861 predicted 1570
8 SASI_Mm01_00096862 predicted 1848
9 SASI_Mm01_00096863 predicted 1843
10 SASI_Mm01_00096864 predicted 1758
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001476670 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00390563 predicted 1106
2 SASI_Mm02_00390564 predicted 321
3 SASI_Mm02_00390565 predicted 455
4 SASI_Mm02_00390566 predicted 1093
5 SASI_Mm02_00390567 predicted 1252
6 SASI_Mm02_00390568 predicted 700
7 SASI_Mm02_00390569 predicted 678
8 SASI_Mm02_00390570 predicted 1118
9 SASI_Mm02_00390571 predicted 1851
10 SASI_Mm02_00390572 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480065 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00414804 predicted 3922
2 SASI_Mm02_00414805 predicted 3726
3 SASI_Mm02_00414806 predicted 3339
4 SASI_Mm02_00414807 predicted 3071
5 SASI_Mm02_00414808 predicted 3475
6 SASI_Mm02_00414809 predicted 4200
7 SASI_Mm02_00414810 predicted 3512
8 SASI_Mm02_00414811 predicted 3071
9 SASI_Mm02_00414812 predicted 3134
10 SASI_Mm02_00414813 predicted 3289
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032538
TTBK1 MISSION shRNA Bacterial Glycerol Stock
tau tubulin kinase 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000200010    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032538.1-4842s1c1
Sequence:CCGGCCCAGGGAACATCGGTCTACTCTCGAGAGTAGACCGATGTTCCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032538.1-3099s1c1
Sequence:CCGGCGTCATGTCTTCCGGTGGACACTCGAGTGTCCACCGGAAGACATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199433    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032538.1-6646s1c1
Sequence:CCGGCCTGAGCCCTTCCTCTGTAAACTCGAGTTTACAGAGGAAGGGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032538.1-1498s1c1
Sequence:CCGGCGGAACAAACTCCGGATCAACCTCGAGGTTGATCCGGAGTTTGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032538
TTBK1 MISSION shRNA shRNA Plasmid DNA
tau tubulin kinase 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000200010    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032538.1-4842s1c1
Sequence:CCGGCCCAGGGAACATCGGTCTACTCTCGAGAGTAGACCGATGTTCCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032538.1-3099s1c1
Sequence:CCGGCGTCATGTCTTCCGGTGGACACTCGAGTGTCCACCGGAAGACATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199433    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032538.1-6646s1c1
Sequence:CCGGCCTGAGCCCTTCCTCTGTAAACTCGAGTTTACAGAGGAAGGGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032538.1-1498s1c1
Sequence:CCGGCGGAACAAACTCCGGATCAACCTCGAGGTTGATCCGGAGTTTGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032538
TTBK1 MISSION shRNA Lentiviral Transduction Particles
tau tubulin kinase 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000200010    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032538.1-4842s1c1
Sequence:CCGGCCCAGGGAACATCGGTCTACTCTCGAGAGTAGACCGATGTTCCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032538.1-3099s1c1
Sequence:CCGGCGTCATGTCTTCCGGTGGACACTCGAGTGTCCACCGGAAGACATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199433    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032538.1-6646s1c1
Sequence:CCGGCCTGAGCCCTTCCTCTGTAAACTCGAGTTTACAGAGGAAGGGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032538.1-1498s1c1
Sequence:CCGGCGGAACAAACTCCGGATCAACCTCGAGGTTGATCCGGAGTTTGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175351
TTBK1 MISSION shRNA Bacterial Glycerol Stock
tau tubulin kinase 1
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000191399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175351.2-1729s1c1
Sequence:CCGGCAACCGAAGAATGTTTACATGCTCGAGCATGTAAACATTCTTCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175351.2-1734s1c1
Sequence:CCGGGAAGAATGTTTACATGCCACACTCGAGTGTGGCATGTAAACATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175351
TTBK1 MISSION shRNA shRNA Plasmid DNA
tau tubulin kinase 1
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000191399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175351.2-1729s1c1
Sequence:CCGGCAACCGAAGAATGTTTACATGCTCGAGCATGTAAACATTCTTCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175351.2-1734s1c1
Sequence:CCGGGAAGAATGTTTACATGCCACACTCGAGTGTGGCATGTAAACATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175351
TTBK1 MISSION shRNA Lentiviral Transduction Particles
tau tubulin kinase 1
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000191399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175351.2-1729s1c1
Sequence:CCGGCAACCGAAGAATGTTTACATGCTCGAGCATGTAAACATTCTTCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175351.2-1734s1c1
Sequence:CCGGGAAGAATGTTTACATGCCACACTCGAGTGTGGCATGTAAACATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_166453
TTBK1 MISSION shRNA Bacterial Glycerol Stock
tau tubulin kinase 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166453.5-1008s1c1
Sequence:CCGGCCAGTTGATCATGTCAGTGTTCTCGAGAACACTGACATGATCAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166453.5-2920s1c1
Sequence:CCGGACCAAAGTTGAGAGGACCTTTCTCGAGAAAGGTCCTCTCAACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166453.5-1356s1c1
Sequence:CCGGGACAGATGTCAACCGGAACAACTCGAGTTGTTCCGGTTGACATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166453.5-87s1c1
Sequence:CCGGTGGGAAGTTATTTCATCCCAACTCGAGTTGGGATGAAATAACTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166453.5-1753s1c1
Sequence:CCGGGAGGAGGATTTCGACAGCAAACTCGAGTTTGCTGTCGAAATCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_166453
TTBK1 MISSION shRNA shRNA Plasmid DNA
tau tubulin kinase 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166453.5-1008s1c1
Sequence:CCGGCCAGTTGATCATGTCAGTGTTCTCGAGAACACTGACATGATCAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166453.5-2920s1c1
Sequence:CCGGACCAAAGTTGAGAGGACCTTTCTCGAGAAAGGTCCTCTCAACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166453.5-1356s1c1
Sequence:CCGGGACAGATGTCAACCGGAACAACTCGAGTTGTTCCGGTTGACATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166453.5-87s1c1
Sequence:CCGGTGGGAAGTTATTTCATCCCAACTCGAGTTGGGATGAAATAACTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166453.5-1753s1c1
Sequence:CCGGGAGGAGGATTTCGACAGCAAACTCGAGTTTGCTGTCGAAATCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_166453
TTBK1 MISSION shRNA Lentiviral Transduction Particles
tau tubulin kinase 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166453.5-1008s1c1
Sequence:CCGGCCAGTTGATCATGTCAGTGTTCTCGAGAACACTGACATGATCAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166453.5-2920s1c1
Sequence:CCGGACCAAAGTTGAGAGGACCTTTCTCGAGAAAGGTCCTCTCAACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166453.5-1356s1c1
Sequence:CCGGGACAGATGTCAACCGGAACAACTCGAGTTGTTCCGGTTGACATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166453.5-87s1c1
Sequence:CCGGTGGGAAGTTATTTCATCCCAACTCGAGTTGGGATGAAATAACTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166453.5-1753s1c1
Sequence:CCGGGAGGAGGATTTCGACAGCAAACTCGAGTTTGCTGTCGAAATCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001162864
TTBK1 MISSION shRNA Bacterial Glycerol Stock
tau tubulin kinase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162864.1-839s21c1
Sequence:CCGGCTAGCCAGGCAGTACACTAACCTCGAGGTTAGTGTACTGCCTGGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162864.1-1141s21c1
Sequence:CCGGCTACTTCACCAAGCCCGATTACTCGAGTAATCGGGCTTGGTGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162864.1-765s21c1
Sequence:CCGGACATCAAGCCGTCCAACTTTGCTCGAGCAAAGTTGGACGGCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162864.1-1923s21c1
Sequence:CCGGACAGCAAGGAGTGGGTCATTACTCGAGTAATGACCCACTCCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162864.1-4714s21c1
Sequence:CCGGCAGGAGAAACAGCCTCAAATTCTCGAGAATTTGAGGCTGTTTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001162864
TTBK1 MISSION shRNA shRNA Plasmid DNA
tau tubulin kinase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162864.1-839s21c1
Sequence:CCGGCTAGCCAGGCAGTACACTAACCTCGAGGTTAGTGTACTGCCTGGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162864.1-1141s21c1
Sequence:CCGGCTACTTCACCAAGCCCGATTACTCGAGTAATCGGGCTTGGTGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162864.1-765s21c1
Sequence:CCGGACATCAAGCCGTCCAACTTTGCTCGAGCAAAGTTGGACGGCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162864.1-1923s21c1
Sequence:CCGGACAGCAAGGAGTGGGTCATTACTCGAGTAATGACCCACTCCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162864.1-4714s21c1
Sequence:CCGGCAGGAGAAACAGCCTCAAATTCTCGAGAATTTGAGGCTGTTTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001162864
TTBK1 MISSION shRNA Lentiviral Transduction Particles
tau tubulin kinase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162864.1-839s21c1
Sequence:CCGGCTAGCCAGGCAGTACACTAACCTCGAGGTTAGTGTACTGCCTGGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162864.1-1141s21c1
Sequence:CCGGCTACTTCACCAAGCCCGATTACTCGAGTAATCGGGCTTGGTGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162864.1-765s21c1
Sequence:CCGGACATCAAGCCGTCCAACTTTGCTCGAGCAAAGTTGGACGGCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162864.1-1923s21c1
Sequence:CCGGACAGCAAGGAGTGGGTCATTACTCGAGTAATGACCCACTCCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162864.1-4714s21c1
Sequence:CCGGCAGGAGAAACAGCCTCAAATTCTCGAGAATTTGAGGCTGTTTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks