EMAIL THIS PAGE TO A FRIEND

TTBK2

tau tubulin kinase 2

Synonyms: SCA11 TTBK
UniProtKB ID: Q6IQ55, O94932, Q6ZN52, Q8IVV1
Gene ID:
Human(146057) Summary: This gene encodes a serine-threonine kinase that putatively phosphorylates tau and tubulin proteins. Mutations in this gene cause spinocerebellar ataxia type 11 (SCA11); a neurodegenerative disease characterized by progressive ataxia and atrophy of the cerebellum and brainstem. [provided by RefSeq, Aug 2009]
Mouse(140810) tau tubulin kinase 2
Rat(311349) tau tubulin kinase 2
naked mole-rat(101719202) tau tubulin kinase 2
Domestic Rabbit(100338586) tau tubulin kinase 2
domestic guinea pig(100713962) tau tubulin kinase 2
cow(541215) tau tubulin kinase 2
sheep(101119052) tau tubulin kinase 2
chicken(423241) tau tubulin kinase 2
Horse(100056539) tau tubulin kinase 2
domestic cat(101081810) tau tubulin kinase 2
dog(487520) tau tubulin kinase 2
148 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080788 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080788 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080788 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173500 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173500 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173500 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU060371 MISSION® esiRNA esiRNA human TTBK2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173500 Rosetta Predictions human pricing
NM_001107766 Rosetta Predictions rat pricing
NM_001024856 Rosetta Predictions mouse pricing
NM_001024857 Rosetta Predictions mouse pricing
NM_080788 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173500 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136137 predicted 1211
2 SASI_Hs01_00136138 predicted 1348
3 SASI_Hs01_00136139 predicted 887
4 SASI_Hs02_00368269 predicted 1137
5 SASI_Hs01_00136140 predicted 3628
6 SASI_Hs01_00136141 predicted 1702
7 SASI_Hs01_00136142 predicted 3422
8 SASI_Hs01_00136143 predicted 4140
9 SASI_Hs01_00136144 predicted 743
10 SASI_Hs02_00368270 predicted 691
11 SASI_Hs01_00136145 predicted 907
12 SASI_Hs01_00136146 predicted 2564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107766 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232055 predicted 2565
2 SASI_Rn02_00232056 predicted 1676
3 SASI_Rn02_00232057 predicted 2817
4 SASI_Rn02_00232058 predicted 928
5 SASI_Rn02_00232059 predicted 542
6 SASI_Rn02_00232060 predicted 3779
7 SASI_Rn02_00232061 predicted 807
8 SASI_Rn02_00232062 predicted 3875
9 SASI_Rn02_00232063 predicted 1509
10 SASI_Rn02_00232064 predicted 3179
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024856 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150120 predicted 2016
2 SASI_Mm01_00150121 predicted 2096
3 SASI_Mm01_00150122 predicted 4319
4 SASI_Mm01_00150123 predicted 1722
5 SASI_Mm01_00150124 predicted 1347
6 SASI_Mm01_00150125 predicted 3513
7 SASI_Mm01_00150126 predicted 2860
8 SASI_Mm01_00150127 predicted 3689
9 SASI_Mm02_00287732 predicted 2104
10 SASI_Mm01_00150128 predicted 3409
11 SASI_Mm01_00150129 predicted 3253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024857 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191453 predicted 1942
2 SASI_Mm01_00191455 predicted 4245
3 SASI_Mm01_00191456 predicted 1653
4 SASI_Mm01_00191457 predicted 1270
5 SASI_Mm02_00287733 predicted 2675
6 SASI_Mm01_00191458 predicted 3441
7 SASI_Mm01_00191459 predicted 2792
8 SASI_Mm01_00191460 predicted 3609
9 SASI_Mm02_00287734 predicted 2035
10 SASI_Mm01_00191461 predicted 3340
11 SASI_Mm01_00191454 predicted 2023
12 SASI_Mm01_00191462 predicted 3180
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080788 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029090 predicted 1765
2 SASI_Mm01_00029092 predicted 4073
3 SASI_Mm01_00029093 predicted 1481
4 SASI_Mm01_00029094 predicted 1098
5 SASI_Mm02_00338209 predicted 2503
6 SASI_Mm01_00029095 predicted 3268
7 SASI_Mm01_00029096 predicted 2622
8 SASI_Mm01_00029097 predicted 3444
9 SASI_Mm02_00338210 predicted 1866
10 SASI_Mm01_00029098 predicted 3166
11 SASI_Mm01_00029091 predicted 1882
12 SASI_Mm01_00029099 predicted 3039
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080788
VALIDATED
TTBK2 MISSION shRNA Bacterial Glycerol Stock
tau tubulin kinase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080788.3-1771s21c1
Sequence:CCGGTGGCACTATGATGACGAATATCTCGAGATATTCGTCATCATAGTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080788.3-1576s21c1
Sequence:CCGGGTAAGGAAGCTACGTTCTATTCTCGAGAATAGAACGTAGCTTCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080788.3-4284s21c1
Sequence:CCGGGATAGGAAATAGAATGGGATTCTCGAGAATCCCATTCTATTTCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080788.3-3522s21c1
Sequence:CCGGAGCCAGGCTACGCAGATATAACTCGAGTTATATCTGCGTAGCCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080788.1-949s1c1
Sequence:CCGGGCACCTTTCTTGACCATATTTCTCGAGAAATATGGTCAAGAAAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080788.1-848s1c1
Sequence:CCGGCCAACTGCCTTGGAGAGAAATCTCGAGATTTCTCTCCAAGGCAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080788.1-228s1c1
Sequence:CCGGCTGGTCAAAGAAAGATGGAAACTCGAGTTTCCATCTTTCTTTGACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080788.1-378s1c1
Sequence:CCGGGCTGTGTTGAAGAAACTGCAACTCGAGTTGCAGTTTCTTCAACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080788.1-1001s1c1
Sequence:CCGGCCAGCTTCTAACATCCGTGTTCTCGAGAACACGGATGTTAGAAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080788
VALIDATED
TTBK2 MISSION shRNA shRNA Plasmid DNA
tau tubulin kinase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080788.3-1771s21c1
Sequence:CCGGTGGCACTATGATGACGAATATCTCGAGATATTCGTCATCATAGTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080788.3-1576s21c1
Sequence:CCGGGTAAGGAAGCTACGTTCTATTCTCGAGAATAGAACGTAGCTTCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080788.3-4284s21c1
Sequence:CCGGGATAGGAAATAGAATGGGATTCTCGAGAATCCCATTCTATTTCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080788.3-3522s21c1
Sequence:CCGGAGCCAGGCTACGCAGATATAACTCGAGTTATATCTGCGTAGCCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080788.1-949s1c1
Sequence:CCGGGCACCTTTCTTGACCATATTTCTCGAGAAATATGGTCAAGAAAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080788.1-848s1c1
Sequence:CCGGCCAACTGCCTTGGAGAGAAATCTCGAGATTTCTCTCCAAGGCAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080788.1-228s1c1
Sequence:CCGGCTGGTCAAAGAAAGATGGAAACTCGAGTTTCCATCTTTCTTTGACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080788.1-378s1c1
Sequence:CCGGGCTGTGTTGAAGAAACTGCAACTCGAGTTGCAGTTTCTTCAACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080788.1-1001s1c1
Sequence:CCGGCCAGCTTCTAACATCCGTGTTCTCGAGAACACGGATGTTAGAAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080788
VALIDATED
TTBK2 MISSION shRNA Lentiviral Transduction Particles
tau tubulin kinase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080788.3-1771s21c1
Sequence:CCGGTGGCACTATGATGACGAATATCTCGAGATATTCGTCATCATAGTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080788.3-1576s21c1
Sequence:CCGGGTAAGGAAGCTACGTTCTATTCTCGAGAATAGAACGTAGCTTCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080788.3-4284s21c1
Sequence:CCGGGATAGGAAATAGAATGGGATTCTCGAGAATCCCATTCTATTTCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080788.3-3522s21c1
Sequence:CCGGAGCCAGGCTACGCAGATATAACTCGAGTTATATCTGCGTAGCCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080788.1-949s1c1
Sequence:CCGGGCACCTTTCTTGACCATATTTCTCGAGAAATATGGTCAAGAAAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080788.1-848s1c1
Sequence:CCGGCCAACTGCCTTGGAGAGAAATCTCGAGATTTCTCTCCAAGGCAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080788.1-228s1c1
Sequence:CCGGCTGGTCAAAGAAAGATGGAAACTCGAGTTTCCATCTTTCTTTGACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080788.1-378s1c1
Sequence:CCGGGCTGTGTTGAAGAAACTGCAACTCGAGTTGCAGTTTCTTCAACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080788.1-1001s1c1
Sequence:CCGGCCAGCTTCTAACATCCGTGTTCTCGAGAACACGGATGTTAGAAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173500
VALIDATED
TTBK2 MISSION shRNA Bacterial Glycerol Stock
tau tubulin kinase 2
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_173500.3-1135s21c1
Sequence:CCGGGGAGCAAGTAGGCTCTATTAACTCGAGTTAATAGAGCCTACTTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_173500.3-693s21c1
Sequence:GTACCGGGGAATGATCGATTCAACTATGCTCGAGCATAGTTGAATCGATCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230527    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_173500.3-4804s21c1
Sequence:CCGGGTCCTAGTTGTACTATCAAATCTCGAGATTTGATAGTACAACTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_173500.3-2386s21c1
Sequence:CCGGAGCGACGCCCACAAGTCTAATCTCGAGATTAGACTTGTGGGCGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173500.3-996s21c1
Sequence:CCGGTTCGAGGGACAGTTCGTTATGCTCGAGCATAACGAACTGTCCCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173500.x-554s1c1
Sequence:CCGGGCTGCAAGGAAAGACCATGTTCTCGAGAACATGGTCTTTCCTTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173500.x-1350s1c1
Sequence:CCGGCCACCATCACTGTCAACCAAACTCGAGTTTGGTTGACAGTGATGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173500.x-4892s1c1
Sequence:CCGGCTACGCAGATATAAAGTCCTACTCGAGTAGGACTTTATATCTGCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173500.x-2660s1c1
Sequence:CCGGCCAGATGAACAGCTTAGCGATCTCGAGATCGCTAAGCTGTTCATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173500.x-5405s1c1
Sequence:CCGGTGCATGTGTGTCCCTGTACTTCTCGAGAAGTACAGGGACACACATGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173500.2-962s1c1
Sequence:CCGGGATGACCTTTGGTCCTTATTCCTCGAGGAATAAGGACCAAAGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173500.2-5370s1c1
Sequence:CCGGCTTTGAAAGGTGTGAGATCTTCTCGAGAAGATCTCACACCTTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173500.2-3213s1c1
Sequence:CCGGGCAATGGATTTATAGCTGTTACTCGAGTAACAGCTATAAATCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173500.2-1118s1c1
Sequence:CCGGCTAGACCATATCTCTTCTTTGCTCGAGCAAAGAAGAGATATGGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_173500.2-5414s1c1
Sequence:CCGGGTCCCTGTACTTTCTATGTAACTCGAGTTACATAGAAAGTACAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173500
VALIDATED
TTBK2 MISSION shRNA shRNA Plasmid DNA
tau tubulin kinase 2
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_173500.3-1135s21c1
Sequence:CCGGGGAGCAAGTAGGCTCTATTAACTCGAGTTAATAGAGCCTACTTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_173500.3-693s21c1
Sequence:GTACCGGGGAATGATCGATTCAACTATGCTCGAGCATAGTTGAATCGATCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230527    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_173500.3-4804s21c1
Sequence:CCGGGTCCTAGTTGTACTATCAAATCTCGAGATTTGATAGTACAACTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_173500.3-2386s21c1
Sequence:CCGGAGCGACGCCCACAAGTCTAATCTCGAGATTAGACTTGTGGGCGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173500.3-996s21c1
Sequence:CCGGTTCGAGGGACAGTTCGTTATGCTCGAGCATAACGAACTGTCCCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173500.x-554s1c1
Sequence:CCGGGCTGCAAGGAAAGACCATGTTCTCGAGAACATGGTCTTTCCTTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173500.x-1350s1c1
Sequence:CCGGCCACCATCACTGTCAACCAAACTCGAGTTTGGTTGACAGTGATGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173500.x-4892s1c1
Sequence:CCGGCTACGCAGATATAAAGTCCTACTCGAGTAGGACTTTATATCTGCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173500.x-2660s1c1
Sequence:CCGGCCAGATGAACAGCTTAGCGATCTCGAGATCGCTAAGCTGTTCATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173500.x-5405s1c1
Sequence:CCGGTGCATGTGTGTCCCTGTACTTCTCGAGAAGTACAGGGACACACATGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173500.2-962s1c1
Sequence:CCGGGATGACCTTTGGTCCTTATTCCTCGAGGAATAAGGACCAAAGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173500.2-5370s1c1
Sequence:CCGGCTTTGAAAGGTGTGAGATCTTCTCGAGAAGATCTCACACCTTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173500.2-3213s1c1
Sequence:CCGGGCAATGGATTTATAGCTGTTACTCGAGTAACAGCTATAAATCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173500.2-1118s1c1
Sequence:CCGGCTAGACCATATCTCTTCTTTGCTCGAGCAAAGAAGAGATATGGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_173500.2-5414s1c1
Sequence:CCGGGTCCCTGTACTTTCTATGTAACTCGAGTTACATAGAAAGTACAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173500
VALIDATED
TTBK2 MISSION shRNA Lentiviral Transduction Particles
tau tubulin kinase 2
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_173500.3-1135s21c1
Sequence:CCGGGGAGCAAGTAGGCTCTATTAACTCGAGTTAATAGAGCCTACTTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_173500.3-693s21c1
Sequence:GTACCGGGGAATGATCGATTCAACTATGCTCGAGCATAGTTGAATCGATCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230527    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_173500.3-4804s21c1
Sequence:CCGGGTCCTAGTTGTACTATCAAATCTCGAGATTTGATAGTACAACTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_173500.3-2386s21c1
Sequence:CCGGAGCGACGCCCACAAGTCTAATCTCGAGATTAGACTTGTGGGCGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173500.3-996s21c1
Sequence:CCGGTTCGAGGGACAGTTCGTTATGCTCGAGCATAACGAACTGTCCCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173500.x-554s1c1
Sequence:CCGGGCTGCAAGGAAAGACCATGTTCTCGAGAACATGGTCTTTCCTTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173500.x-1350s1c1
Sequence:CCGGCCACCATCACTGTCAACCAAACTCGAGTTTGGTTGACAGTGATGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173500.x-4892s1c1
Sequence:CCGGCTACGCAGATATAAAGTCCTACTCGAGTAGGACTTTATATCTGCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173500.x-2660s1c1
Sequence:CCGGCCAGATGAACAGCTTAGCGATCTCGAGATCGCTAAGCTGTTCATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173500.x-5405s1c1
Sequence:CCGGTGCATGTGTGTCCCTGTACTTCTCGAGAAGTACAGGGACACACATGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173500.2-962s1c1
Sequence:CCGGGATGACCTTTGGTCCTTATTCCTCGAGGAATAAGGACCAAAGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173500.2-5370s1c1
Sequence:CCGGCTTTGAAAGGTGTGAGATCTTCTCGAGAAGATCTCACACCTTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173500.2-3213s1c1
Sequence:CCGGGCAATGGATTTATAGCTGTTACTCGAGTAACAGCTATAAATCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173500.2-1118s1c1
Sequence:CCGGCTAGACCATATCTCTTCTTTGCTCGAGCAAAGAAGAGATATGGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_173500.2-5414s1c1
Sequence:CCGGGTCCCTGTACTTTCTATGTAACTCGAGTTACATAGAAAGTACAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks