EMAIL THIS PAGE TO A FRIEND

TTC12

tetratricopeptide repeat domain 12

Synonyms: TPARM
UniProtKB ID: Q9H892, Q8N5H9, Q9NWY3
Gene ID:
Mouse(235330) tetratricopeptide repeat domain 12
Rat(300696) tetratricopeptide repeat domain 12
naked mole-rat(101709779) tetratricopeptide repeat domain 12
Domestic Rabbit(100347871) tetratricopeptide repeat domain 12
domestic guinea pig(100714221) tetratricopeptide repeat domain 12
cow(515758) tetratricopeptide repeat domain 12
sheep(101109209) tetratricopeptide repeat domain 12
Zebrafish(563791) tetratricopeptide repeat domain 12
Horse(100070643) tetratricopeptide repeat domain 12
domestic cat(101096598) tetratricopeptide repeat domain 12
dog(479434) tetratricopeptide repeat domain 12
chicken(770784) tetratricopeptide repeat domain 12
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017868 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017868 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017868 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172770 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172770 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172770 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017868 Rosetta Predictions human pricing
NM_001004246 Rosetta Predictions rat pricing
NM_172770 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017868 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212451 predicted 1848
2 SASI_Hs01_00212453 predicted 727
3 SASI_Hs01_00212454 predicted 445
4 SASI_Hs01_00212455 predicted 445
5 SASI_Hs01_00212456 predicted 226
6 SASI_Hs01_00212457 predicted 443
7 SASI_Hs01_00212458 predicted 1863
8 SASI_Hs01_00212459 predicted 1730
9 SASI_Hs01_00212460 predicted 2024
10 SASI_Hs02_00350797 predicted 736
11 SASI_Hs01_00212452 predicted 932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004246 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077213 predicted 1802
2 SASI_Rn01_00077214 predicted 1060
3 SASI_Rn01_00077215 predicted 636
4 SASI_Rn02_00198260 predicted 1256
5 SASI_Rn01_00077217 predicted 207
6 SASI_Rn01_00077218 predicted 1500
7 SASI_Rn01_00077219 predicted 745
8 SASI_Rn01_00077220 predicted 975
9 SASI_Rn01_00077221 predicted 593
10 SASI_Rn01_00077222 predicted 1362
11 SASI_Rn01_00077216 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172770 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095351 predicted 1858
2 SASI_Mm01_00095352 predicted 283
3 SASI_Mm01_00095353 predicted 593
4 SASI_Mm01_00095354 predicted 717
5 SASI_Mm01_00095355 predicted 1555
6 SASI_Mm01_00095356 predicted 1624
7 SASI_Mm01_00095357 predicted 1684
8 SASI_Mm01_00095358 predicted 1432
9 SASI_Mm01_00095359 predicted 598
10 SASI_Mm01_00095360 predicted 1293
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017868
TTC12 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 12
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017868.3-537s21c1
Sequence:CCGGCAACCGAGCCCAGGCTTATATCTCGAGATATAAGCCTGGGCTCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017868.3-1859s21c1
Sequence:CCGGTACTAGCTATCTGCACGAATACTCGAGTATTCGTGCAGATAGCTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017868.3-978s21c1
Sequence:CCGGCAGTGACAACGAGGTCATAAGCTCGAGCTTATGACCTCGTTGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017868.2-949s1c1
Sequence:CCGGGCAGTTGAAGAAATGGTCTGTCTCGAGACAGACCATTTCTTCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017868.2-1755s1c1
Sequence:CCGGGACTGCATCACGTTATGCTATCTCGAGATAGCATAACGTGATGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017868.2-2149s1c1
Sequence:CCGGGAGATGTTTCACATGCTAGTACTCGAGTACTAGCATGTGAAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017868.2-373s1c1
Sequence:CCGGGCATTTGCTGAAGGCAATTATCTCGAGATAATTGCCTTCAGCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017868.2-1705s1c1
Sequence:CCGGCGAGCAGGAGTGGTAAAGAAACTCGAGTTTCTTTACCACTCCTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157155    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017868.2-2346s1c1
Sequence:CCGGGATGAGGAAACTGAGGTGCAACTCGAGTTGCACCTCAGTTTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017868.2-1024s1c1
Sequence:CCGGCGTGTGCTAGTGATACACCATCTCGAGATGGTGTATCACTAGCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017868
TTC12 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 12
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017868.3-537s21c1
Sequence:CCGGCAACCGAGCCCAGGCTTATATCTCGAGATATAAGCCTGGGCTCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017868.3-1859s21c1
Sequence:CCGGTACTAGCTATCTGCACGAATACTCGAGTATTCGTGCAGATAGCTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017868.3-978s21c1
Sequence:CCGGCAGTGACAACGAGGTCATAAGCTCGAGCTTATGACCTCGTTGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017868.2-949s1c1
Sequence:CCGGGCAGTTGAAGAAATGGTCTGTCTCGAGACAGACCATTTCTTCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017868.2-1755s1c1
Sequence:CCGGGACTGCATCACGTTATGCTATCTCGAGATAGCATAACGTGATGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017868.2-2149s1c1
Sequence:CCGGGAGATGTTTCACATGCTAGTACTCGAGTACTAGCATGTGAAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017868.2-373s1c1
Sequence:CCGGGCATTTGCTGAAGGCAATTATCTCGAGATAATTGCCTTCAGCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017868.2-1705s1c1
Sequence:CCGGCGAGCAGGAGTGGTAAAGAAACTCGAGTTTCTTTACCACTCCTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157155    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017868.2-2346s1c1
Sequence:CCGGGATGAGGAAACTGAGGTGCAACTCGAGTTGCACCTCAGTTTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017868.2-1024s1c1
Sequence:CCGGCGTGTGCTAGTGATACACCATCTCGAGATGGTGTATCACTAGCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017868
TTC12 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 12
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017868.3-537s21c1
Sequence:CCGGCAACCGAGCCCAGGCTTATATCTCGAGATATAAGCCTGGGCTCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017868.3-1859s21c1
Sequence:CCGGTACTAGCTATCTGCACGAATACTCGAGTATTCGTGCAGATAGCTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017868.3-978s21c1
Sequence:CCGGCAGTGACAACGAGGTCATAAGCTCGAGCTTATGACCTCGTTGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017868.2-949s1c1
Sequence:CCGGGCAGTTGAAGAAATGGTCTGTCTCGAGACAGACCATTTCTTCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017868.2-1755s1c1
Sequence:CCGGGACTGCATCACGTTATGCTATCTCGAGATAGCATAACGTGATGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017868.2-2149s1c1
Sequence:CCGGGAGATGTTTCACATGCTAGTACTCGAGTACTAGCATGTGAAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017868.2-373s1c1
Sequence:CCGGGCATTTGCTGAAGGCAATTATCTCGAGATAATTGCCTTCAGCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017868.2-1705s1c1
Sequence:CCGGCGAGCAGGAGTGGTAAAGAAACTCGAGTTTCTTTACCACTCCTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157155    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017868.2-2346s1c1
Sequence:CCGGGATGAGGAAACTGAGGTGCAACTCGAGTTGCACCTCAGTTTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017868.2-1024s1c1
Sequence:CCGGCGTGTGCTAGTGATACACCATCTCGAGATGGTGTATCACTAGCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172770
TTC12 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 12
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172770.3-1887s21c1
Sequence:CCGGGAAGTAGTGAGACTTGATAAACTCGAGTTTATCAAGTCTCACTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172770.3-1846s21c1
Sequence:CCGGTACTGGCTATCTGCACGAACACTCGAGTGTTCGTGCAGATAGCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172770.3-2586s21c1
Sequence:CCGGTGCAGCACTCAGCCCTATAAACTCGAGTTTATAGGGCTGAGTGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172770.3-1823s21c1
Sequence:CCGGTGCATCACGTTACGCCATAAACTCGAGTTTATGGCGTAACGTGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172770.3-1769s21c1
Sequence:CCGGGACAGCAGGAGTGGTCAAGAACTCGAGTTCTTGACCACTCCTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183640    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172770.1-3436s1c1
Sequence:CCGGGCAGATATTGTCTTCACTATACTCGAGTATAGTGAAGACAATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172770.1-663s1c1
Sequence:CCGGCAGCAAGGCTAAAGAATGTTACTCGAGTAACATTCTTTAGCCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172770
TTC12 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 12
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172770.3-1887s21c1
Sequence:CCGGGAAGTAGTGAGACTTGATAAACTCGAGTTTATCAAGTCTCACTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172770.3-1846s21c1
Sequence:CCGGTACTGGCTATCTGCACGAACACTCGAGTGTTCGTGCAGATAGCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172770.3-2586s21c1
Sequence:CCGGTGCAGCACTCAGCCCTATAAACTCGAGTTTATAGGGCTGAGTGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172770.3-1823s21c1
Sequence:CCGGTGCATCACGTTACGCCATAAACTCGAGTTTATGGCGTAACGTGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172770.3-1769s21c1
Sequence:CCGGGACAGCAGGAGTGGTCAAGAACTCGAGTTCTTGACCACTCCTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183640    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172770.1-3436s1c1
Sequence:CCGGGCAGATATTGTCTTCACTATACTCGAGTATAGTGAAGACAATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172770.1-663s1c1
Sequence:CCGGCAGCAAGGCTAAAGAATGTTACTCGAGTAACATTCTTTAGCCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172770
TTC12 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 12
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172770.3-1887s21c1
Sequence:CCGGGAAGTAGTGAGACTTGATAAACTCGAGTTTATCAAGTCTCACTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172770.3-1846s21c1
Sequence:CCGGTACTGGCTATCTGCACGAACACTCGAGTGTTCGTGCAGATAGCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172770.3-2586s21c1
Sequence:CCGGTGCAGCACTCAGCCCTATAAACTCGAGTTTATAGGGCTGAGTGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172770.3-1823s21c1
Sequence:CCGGTGCATCACGTTACGCCATAAACTCGAGTTTATGGCGTAACGTGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172770.3-1769s21c1
Sequence:CCGGGACAGCAGGAGTGGTCAAGAACTCGAGTTCTTGACCACTCCTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183640    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172770.1-3436s1c1
Sequence:CCGGGCAGATATTGTCTTCACTATACTCGAGTATAGTGAAGACAATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172770.1-663s1c1
Sequence:CCGGCAGCAAGGCTAAAGAATGTTACTCGAGTAACATTCTTTAGCCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks