EMAIL THIS PAGE TO A FRIEND

TTC13

tetratricopeptide repeat domain 13

UniProtKB ID: Q8NBP0, B1AQI1, B1AQI2, Q8IVP8, Q8NBI0, Q8ND20
Gene ID:
Mouse(234875) tetratricopeptide repeat domain 13
Rat(292095) tetratricopeptide repeat domain 13
Zebrafish(100170789) tetratricopeptide repeat domain 13
chicken(421545) tetratricopeptide repeat domain 13
dog(488976) tetratricopeptide repeat domain 13
Horse(100061024) tetratricopeptide repeat domain 13
domestic cat(101093210) tetratricopeptide repeat domain 13
cow(519575) tetratricopeptide repeat domain 13
sheep(101110205) tetratricopeptide repeat domain 13
domestic guinea pig(100719891) tetratricopeptide repeat domain 13
Domestic Rabbit(100357412) tetratricopeptide repeat domain 13
naked mole-rat(101715011) tetratricopeptide repeat domain 13
152 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024525 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024525 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024525 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145607 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145607 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145607 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122835 Rosetta Predictions human pricing
NM_024525 Rosetta Predictions human pricing
XM_001054055 Rosetta Predictions rat pricing
XM_001054245 Rosetta Predictions rat pricing
XM_001076402 Rosetta Predictions rat pricing
XM_214720 Rosetta Predictions rat pricing
NM_145607 Rosetta Predictions mouse pricing
XM_358379 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122835 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327437 predicted 1838
2 SASI_Hs02_00327438 predicted 2445
3 SASI_Hs02_00327439 predicted 1172
4 SASI_Hs02_00327440 predicted 2398
5 SASI_Hs02_00327441 predicted 1937
6 SASI_Hs02_00327442 predicted 980
7 SASI_Hs02_00327443 predicted 2369
8 SASI_Hs02_00327444 predicted 1500
9 SASI_Hs02_00327445 predicted 2111
10 SASI_Hs02_00327446 predicted 1931
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024525 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084214 predicted 1994
2 SASI_Hs01_00084217 predicted 2603
3 SASI_Hs02_00356815 predicted 1335
4 SASI_Hs01_00084218 predicted 2552
5 SASI_Hs02_00356816 predicted 2097
6 SASI_Hs01_00084219 predicted 1136
7 SASI_Hs01_00084215 predicted 2529
8 SASI_Hs01_00084220 predicted 1653
9 SASI_Hs01_00084222 predicted 2275
10 SASI_Hs02_00356817 predicted 2089
11 SASI_Hs01_00084216 predicted 1776
12 SASI_Hs01_00084221 predicted 869
13 SASI_Hs01_00084223 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054055 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00274517 predicted 265
2 SASI_Rn02_00274518 predicted 1972
3 SASI_Rn02_00274519 predicted 2109
4 SASI_Rn02_00274520 predicted 1259
5 SASI_Rn02_00274521 predicted 2134
6 SASI_Rn02_00274522 predicted 2053
7 SASI_Rn02_00274523 predicted 525
8 SASI_Rn02_00274524 predicted 922
9 SASI_Rn02_00274525 predicted 2459
10 SASI_Rn02_00274526 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054245 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275224 predicted 266
2 SASI_Rn02_00275225 predicted 1896
3 SASI_Rn02_00275226 predicted 1973
4 SASI_Rn02_00275227 predicted 2109
5 SASI_Rn02_00275228 predicted 1264
6 SASI_Rn02_00275229 predicted 2137
7 SASI_Rn02_00275230 predicted 2062
8 SASI_Rn02_00275231 predicted 528
9 SASI_Rn02_00275232 predicted 925
10 SASI_Rn02_00275233 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076402 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353109 predicted 263
2 SASI_Rn02_00353110 predicted 1971
3 SASI_Rn02_00353111 predicted 2112
4 SASI_Rn02_00353112 predicted 1260
5 SASI_Rn02_00353113 predicted 2138
6 SASI_Rn02_00353114 predicted 2058
7 SASI_Rn02_00353115 predicted 529
8 SASI_Rn02_00353116 predicted 923
9 SASI_Rn02_00353117 predicted 2464
10 SASI_Rn02_00353118 predicted 511
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214720 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375545 predicted 267
2 SASI_Rn02_00375546 predicted 1903
3 SASI_Rn02_00375547 predicted 1976
4 SASI_Rn02_00375548 predicted 2118
5 SASI_Rn02_00375549 predicted 1257
6 SASI_Rn02_00375550 predicted 2139
7 SASI_Rn02_00375551 predicted 2057
8 SASI_Rn02_00375552 predicted 533
9 SASI_Rn02_00375553 predicted 926
10 SASI_Rn02_00375554 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145607 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341165 predicted 1479
2 SASI_Mm02_00341166 predicted 1667
3 SASI_Mm02_00341167 predicted 885
4 SASI_Mm02_00341168 predicted 1273
5 SASI_Mm02_00341169 predicted 363
6 SASI_Mm02_00341170 predicted 1202
7 SASI_Mm02_00341171 predicted 1730
8 SASI_Mm02_00341172 predicted 683
9 SASI_Mm02_00341173 predicted 1823
10 SASI_Mm02_00341174 predicted 1904
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_358379 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213201 predicted 2477
2 SASI_Mm01_00213202 predicted 2540
3 SASI_Mm01_00213203 predicted 2550
4 SASI_Mm01_00213204 predicted 2538
5 SASI_Mm01_00213205 predicted 2625
6 SASI_Mm01_00213206 predicted 2603
7 SASI_Mm01_00213207 predicted 2456
8 SASI_Mm01_00213208 predicted 2578
9 SASI_Mm01_00213209 predicted 2460
10 SASI_Mm01_00213210 predicted 2410
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024525
TTC13 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 13
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024525.2-543s1c1
Sequence:CCGGGCAATTTATGGCCGAGGGATACTCGAGTATCCCTCGGCCATAAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024525.2-985s1c1
Sequence:CCGGCATATAGAGAACTGGGCAATTCTCGAGAATTGCCCAGTTCTCTATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024525.2-2512s1c1
Sequence:CCGGCAGAAACGTTTCCAACGTTAACTCGAGTTAACGTTGGAAACGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024525.2-2523s1c1
Sequence:CCGGCCAACGTTAAGATCGATGATTCTCGAGAATCATCGATCTTAACGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024525.2-1713s1c1
Sequence:CCGGGCAGTTAAATGGAGAAGGATTCTCGAGAATCCTTCTCCATTTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024525.2-1276s1c1
Sequence:CCGGGCCCTGAGTATCTTAAAGTAACTCGAGTTACTTTAAGATACTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024525.2-2436s1c1
Sequence:CCGGGCCTTTAGCAAAGTCGCCAAACTCGAGTTTGGCGACTTTGCTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024525.2-2137s1c1
Sequence:CCGGCCACGGAAGAAAGGACACAATCTCGAGATTGTGTCCTTTCTTCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137854    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024525.2-2790s1c1
Sequence:CCGGGCTACTTGACTTGGAGGGAAACTCGAGTTTCCCTCCAAGTCAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024525.2-711s1c1
Sequence:CCGGGCAGTGAATGACCTCACTAAACTCGAGTTTAGTGAGGTCATTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024525.3-1180s21c1
Sequence:CCGGTAATGAAGTGTGCCAGTATATCTCGAGATATACTGGCACACTTCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024525.3-2094s21c1
Sequence:CCGGATGGATTCACAATCACGATTACTCGAGTAATCGTGATTGTGAATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024525.3-971s21c1
Sequence:CCGGGTTGACTTTATTGATGCATATCTCGAGATATGCATCAATAAAGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024525
TTC13 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 13
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024525.2-543s1c1
Sequence:CCGGGCAATTTATGGCCGAGGGATACTCGAGTATCCCTCGGCCATAAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024525.2-985s1c1
Sequence:CCGGCATATAGAGAACTGGGCAATTCTCGAGAATTGCCCAGTTCTCTATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024525.2-2512s1c1
Sequence:CCGGCAGAAACGTTTCCAACGTTAACTCGAGTTAACGTTGGAAACGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024525.2-2523s1c1
Sequence:CCGGCCAACGTTAAGATCGATGATTCTCGAGAATCATCGATCTTAACGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024525.2-1713s1c1
Sequence:CCGGGCAGTTAAATGGAGAAGGATTCTCGAGAATCCTTCTCCATTTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024525.2-1276s1c1
Sequence:CCGGGCCCTGAGTATCTTAAAGTAACTCGAGTTACTTTAAGATACTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024525.2-2436s1c1
Sequence:CCGGGCCTTTAGCAAAGTCGCCAAACTCGAGTTTGGCGACTTTGCTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024525.2-2137s1c1
Sequence:CCGGCCACGGAAGAAAGGACACAATCTCGAGATTGTGTCCTTTCTTCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137854    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024525.2-2790s1c1
Sequence:CCGGGCTACTTGACTTGGAGGGAAACTCGAGTTTCCCTCCAAGTCAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024525.2-711s1c1
Sequence:CCGGGCAGTGAATGACCTCACTAAACTCGAGTTTAGTGAGGTCATTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024525.3-1180s21c1
Sequence:CCGGTAATGAAGTGTGCCAGTATATCTCGAGATATACTGGCACACTTCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024525.3-2094s21c1
Sequence:CCGGATGGATTCACAATCACGATTACTCGAGTAATCGTGATTGTGAATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024525.3-971s21c1
Sequence:CCGGGTTGACTTTATTGATGCATATCTCGAGATATGCATCAATAAAGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024525
TTC13 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 13
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024525.2-543s1c1
Sequence:CCGGGCAATTTATGGCCGAGGGATACTCGAGTATCCCTCGGCCATAAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024525.2-985s1c1
Sequence:CCGGCATATAGAGAACTGGGCAATTCTCGAGAATTGCCCAGTTCTCTATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024525.2-2512s1c1
Sequence:CCGGCAGAAACGTTTCCAACGTTAACTCGAGTTAACGTTGGAAACGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024525.2-2523s1c1
Sequence:CCGGCCAACGTTAAGATCGATGATTCTCGAGAATCATCGATCTTAACGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024525.2-1713s1c1
Sequence:CCGGGCAGTTAAATGGAGAAGGATTCTCGAGAATCCTTCTCCATTTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024525.2-1276s1c1
Sequence:CCGGGCCCTGAGTATCTTAAAGTAACTCGAGTTACTTTAAGATACTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024525.2-2436s1c1
Sequence:CCGGGCCTTTAGCAAAGTCGCCAAACTCGAGTTTGGCGACTTTGCTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024525.2-2137s1c1
Sequence:CCGGCCACGGAAGAAAGGACACAATCTCGAGATTGTGTCCTTTCTTCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137854    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024525.2-2790s1c1
Sequence:CCGGGCTACTTGACTTGGAGGGAAACTCGAGTTTCCCTCCAAGTCAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024525.2-711s1c1
Sequence:CCGGGCAGTGAATGACCTCACTAAACTCGAGTTTAGTGAGGTCATTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024525.3-1180s21c1
Sequence:CCGGTAATGAAGTGTGCCAGTATATCTCGAGATATACTGGCACACTTCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024525.3-2094s21c1
Sequence:CCGGATGGATTCACAATCACGATTACTCGAGTAATCGTGATTGTGAATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024525.3-971s21c1
Sequence:CCGGGTTGACTTTATTGATGCATATCTCGAGATATGCATCAATAAAGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145607
TTC13 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 13
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145607.3-522s21c1
Sequence:CCGGTTGACTTTATCGATGCATATACTCGAGTATATGCATCGATAAAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145607.3-2834s21c1
Sequence:CCGGGCCAATCACTGAACCATATTTCTCGAGAAATATGGTTCAGTGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145607.3-1726s21c1
Sequence:CCGGACAGCTGTATCACGCTGAAATCTCGAGATTTCAGCGTGATACAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145607.3-1371s21c1
Sequence:CCGGTCAATAACCACATCAACTTAACTCGAGTTAAGTTGATGTGGTTATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145607.3-1815s21c1
Sequence:CCGGCTGATGCTGTCTGCAACTTAACTCGAGTTAAGTTGCAGACAGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145607
TTC13 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 13
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145607.3-522s21c1
Sequence:CCGGTTGACTTTATCGATGCATATACTCGAGTATATGCATCGATAAAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145607.3-2834s21c1
Sequence:CCGGGCCAATCACTGAACCATATTTCTCGAGAAATATGGTTCAGTGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145607.3-1726s21c1
Sequence:CCGGACAGCTGTATCACGCTGAAATCTCGAGATTTCAGCGTGATACAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145607.3-1371s21c1
Sequence:CCGGTCAATAACCACATCAACTTAACTCGAGTTAAGTTGATGTGGTTATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145607.3-1815s21c1
Sequence:CCGGCTGATGCTGTCTGCAACTTAACTCGAGTTAAGTTGCAGACAGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145607
TTC13 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 13
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145607.3-522s21c1
Sequence:CCGGTTGACTTTATCGATGCATATACTCGAGTATATGCATCGATAAAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145607.3-2834s21c1
Sequence:CCGGGCCAATCACTGAACCATATTTCTCGAGAAATATGGTTCAGTGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145607.3-1726s21c1
Sequence:CCGGACAGCTGTATCACGCTGAAATCTCGAGATTTCAGCGTGATACAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145607.3-1371s21c1
Sequence:CCGGTCAATAACCACATCAACTTAACTCGAGTTAAGTTGATGTGGTTATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145607.3-1815s21c1
Sequence:CCGGCTGATGCTGTCTGCAACTTAACTCGAGTTAAGTTGCAGACAGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks