EMAIL THIS PAGE TO A FRIEND

TTC14

tetratricopeptide repeat domain 14

Synonyms: DRDL5813 PRO19630
UniProtKB ID: Q96N46, G5E9X0, Q6UWJ7, Q8TF22
Gene ID:
Mouse(67120) tetratricopeptide repeat domain 14
Rat(310314) tetratricopeptide repeat domain 14
naked mole-rat(101719861) tetratricopeptide repeat domain 14
domestic guinea pig(100726190) tetratricopeptide repeat domain 14
cow(512635) tetratricopeptide repeat domain 14
sheep(101105376) tetratricopeptide repeat domain 14
Zebrafish(541501) tetratricopeptide repeat domain 14
Horse(100058491) tetratricopeptide repeat domain 14
domestic cat(101092592) tetratricopeptide repeat domain 14
chicken(424970) tetratricopeptide repeat domain 14
dog(478641) tetratricopeptide repeat domain 14
182 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA009295 Anti-TTC14 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
AV41101 Anti-TTC14 antibody produced in rabbit affinity isolated antibody guinea pig, human, horse, rabbit, canine
western blot pricing
SAB2103277 Anti-TTC14, (N-terminal) antibody produced in rabbit affinity isolated antibody rat, mouse, horse, human, rabbit, guinea pig, bovine, canine
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133462 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133462 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133462 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025978 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025978 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025978 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042601 Rosetta Predictions human pricing
NM_133462 Rosetta Predictions human pricing
NM_001107666 Rosetta Predictions rat pricing
NM_025978 Rosetta Predictions mouse pricing
NM_027619 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042601 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310768 predicted 418
2 SASI_Hs02_00310769 predicted 883
3 SASI_Hs02_00310770 predicted 290
4 SASI_Hs02_00310771 predicted 835
5 SASI_Hs02_00310772 predicted 505
6 SASI_Hs02_00310773 predicted 477
7 SASI_Hs02_00310774 predicted 574
8 SASI_Hs02_00310775 predicted 760
9 SASI_Hs02_00310776 predicted 431
10 SASI_Hs02_00310777 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133462 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024181 predicted 415
2 SASI_Hs01_00024182 predicted 762
3 SASI_Hs01_00024183 predicted 880
4 SASI_Hs01_00024184 predicted 287
5 SASI_Hs01_00024185 predicted 838
6 SASI_Hs01_00024186 predicted 506
7 SASI_Hs01_00024187 predicted 478
8 SASI_Hs01_00024188 predicted 578
9 SASI_Hs01_00024189 predicted 427
10 SASI_Hs02_00363157 predicted 1039
11 SASI_Hs01_00024180 predicted 704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107666 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231075 predicted 1835
2 SASI_Rn02_00231076 predicted 451
3 SASI_Rn02_00231077 predicted 229
4 SASI_Rn02_00231078 predicted 329
5 SASI_Rn02_00231079 predicted 2391
6 SASI_Rn02_00231080 predicted 520
7 SASI_Rn02_00231081 predicted 982
8 SASI_Rn02_00231082 predicted 570
9 SASI_Rn02_00231083 predicted 707
10 SASI_Rn02_00231084 predicted 1757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025978 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329400 predicted 478
2 SASI_Mm02_00329401 predicted 476
3 SASI_Mm02_00329402 predicted 249
4 SASI_Mm02_00329403 predicted 246
5 SASI_Mm02_00329404 predicted 438
6 SASI_Mm02_00329405 predicted 1052
7 SASI_Mm02_00329406 predicted 1008
8 SASI_Mm02_00329407 predicted 379
9 SASI_Mm02_00329408 predicted 590
10 SASI_Mm02_00329409 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027619 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332468 predicted 476
2 SASI_Mm02_00332469 predicted 2329
3 SASI_Mm02_00332470 predicted 250
4 SASI_Mm02_00332471 predicted 244
5 SASI_Mm02_00332472 predicted 444
6 SASI_Mm02_00332473 predicted 1053
7 SASI_Mm02_00332474 predicted 1009
8 SASI_Mm02_00332475 predicted 379
9 SASI_Mm02_00332476 predicted 909
10 SASI_Mm02_00332477 predicted 1141
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133462
VALIDATED
TTC14 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 14
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133462.2-484s21c1
Sequence:CCGGATATTGAGCGTGGTGATATAGCTCGAGCTATATCACCACGCTCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133462.2-758s21c1
Sequence:CCGGACCACACCTATCTGGTATTAACTCGAGTTAATACCAGATAGGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133462.2-2216s21c1
Sequence:CCGGTGAGCAAAGATACCGTTTAAACTCGAGTTTAAACGGTATCTTTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133462.2-819s21c1
Sequence:GTACCGGAGGAGAAGTGTTGAGCTAAATCTCGAGATTTAGCTCAACACTTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133462.1-393s1c1
Sequence:CCGGGCCACCTTTAGAGCAATTCATCTCGAGATGAATTGCTCTAAAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133462.1-1838s1c1
Sequence:CCGGCACTTGAAATACCGGATGATTCTCGAGAATCATCCGGTATTTCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133462.1-2482s1c1
Sequence:CCGGGCAGAAATCTCTGCTTCTAAACTCGAGTTTAGAAGCAGAGATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146339    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133462.1-2468s1c1
Sequence:CCGGCATAACAGTTGAGTGCAGAAACTCGAGTTTCTGCACTCAACTGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_133462.1-2278s1c1
Sequence:CCGGGATGCACTAAGTAGCAAAGAACTCGAGTTCTTTGCTACTTAGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133462
VALIDATED
TTC14 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 14
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133462.2-484s21c1
Sequence:CCGGATATTGAGCGTGGTGATATAGCTCGAGCTATATCACCACGCTCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133462.2-758s21c1
Sequence:CCGGACCACACCTATCTGGTATTAACTCGAGTTAATACCAGATAGGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133462.2-2216s21c1
Sequence:CCGGTGAGCAAAGATACCGTTTAAACTCGAGTTTAAACGGTATCTTTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133462.2-819s21c1
Sequence:GTACCGGAGGAGAAGTGTTGAGCTAAATCTCGAGATTTAGCTCAACACTTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133462.1-393s1c1
Sequence:CCGGGCCACCTTTAGAGCAATTCATCTCGAGATGAATTGCTCTAAAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133462.1-1838s1c1
Sequence:CCGGCACTTGAAATACCGGATGATTCTCGAGAATCATCCGGTATTTCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133462.1-2482s1c1
Sequence:CCGGGCAGAAATCTCTGCTTCTAAACTCGAGTTTAGAAGCAGAGATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146339    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133462.1-2468s1c1
Sequence:CCGGCATAACAGTTGAGTGCAGAAACTCGAGTTTCTGCACTCAACTGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_133462.1-2278s1c1
Sequence:CCGGGATGCACTAAGTAGCAAAGAACTCGAGTTCTTTGCTACTTAGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133462
VALIDATED
TTC14 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 14
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133462.2-484s21c1
Sequence:CCGGATATTGAGCGTGGTGATATAGCTCGAGCTATATCACCACGCTCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133462.2-758s21c1
Sequence:CCGGACCACACCTATCTGGTATTAACTCGAGTTAATACCAGATAGGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133462.2-2216s21c1
Sequence:CCGGTGAGCAAAGATACCGTTTAAACTCGAGTTTAAACGGTATCTTTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133462.2-819s21c1
Sequence:GTACCGGAGGAGAAGTGTTGAGCTAAATCTCGAGATTTAGCTCAACACTTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133462.1-393s1c1
Sequence:CCGGGCCACCTTTAGAGCAATTCATCTCGAGATGAATTGCTCTAAAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133462.1-1838s1c1
Sequence:CCGGCACTTGAAATACCGGATGATTCTCGAGAATCATCCGGTATTTCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133462.1-2482s1c1
Sequence:CCGGGCAGAAATCTCTGCTTCTAAACTCGAGTTTAGAAGCAGAGATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146339    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133462.1-2468s1c1
Sequence:CCGGCATAACAGTTGAGTGCAGAAACTCGAGTTTCTGCACTCAACTGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_133462.1-2278s1c1
Sequence:CCGGGATGCACTAAGTAGCAAAGAACTCGAGTTCTTTGCTACTTAGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025978
TTC14 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 14
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025978.2-1479s1c1
Sequence:CCGGGCATTATAGTACCACTGCTTTCTCGAGAAAGCAGTGGTACTATAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025978.2-420s1c1
Sequence:CCGGGAGATATTGAACGTGGTGATACTCGAGTATCACCACGTTCAATATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025978.2-514s1c1
Sequence:CCGGCGTGAGAGATATTTCGCACTTCTCGAGAAGTGCGAAATATCTCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025978.2-1170s1c1
Sequence:CCGGGCCCAACTCATAGGAATGCAACTCGAGTTGCATTCCTATGAGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025978.2-419s1c1
Sequence:CCGGCGAGATATTGAACGTGGTGATCTCGAGATCACCACGTTCAATATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025978
TTC14 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 14
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025978.2-1479s1c1
Sequence:CCGGGCATTATAGTACCACTGCTTTCTCGAGAAAGCAGTGGTACTATAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025978.2-420s1c1
Sequence:CCGGGAGATATTGAACGTGGTGATACTCGAGTATCACCACGTTCAATATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025978.2-514s1c1
Sequence:CCGGCGTGAGAGATATTTCGCACTTCTCGAGAAGTGCGAAATATCTCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025978.2-1170s1c1
Sequence:CCGGGCCCAACTCATAGGAATGCAACTCGAGTTGCATTCCTATGAGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025978.2-419s1c1
Sequence:CCGGCGAGATATTGAACGTGGTGATCTCGAGATCACCACGTTCAATATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025978
TTC14 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 14
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025978.2-1479s1c1
Sequence:CCGGGCATTATAGTACCACTGCTTTCTCGAGAAAGCAGTGGTACTATAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025978.2-420s1c1
Sequence:CCGGGAGATATTGAACGTGGTGATACTCGAGTATCACCACGTTCAATATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025978.2-514s1c1
Sequence:CCGGCGTGAGAGATATTTCGCACTTCTCGAGAAGTGCGAAATATCTCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025978.2-1170s1c1
Sequence:CCGGGCCCAACTCATAGGAATGCAACTCGAGTTGCATTCCTATGAGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025978.2-419s1c1
Sequence:CCGGCGAGATATTGAACGTGGTGATCTCGAGATCACCACGTTCAATATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks