EMAIL THIS PAGE TO A FRIEND

TTC16

tetratricopeptide repeat domain 16

UniProtKB ID: Q8NEE8, Q5JU66, Q96M72
Gene ID:
Mouse(338348) tetratricopeptide repeat domain 16
Rat(366019) tetratricopeptide repeat domain 16
cow(531619) tetratricopeptide repeat domain 16
sheep(101103052) tetratricopeptide repeat domain 16
domestic guinea pig(100726014) tetratricopeptide repeat domain 16
naked mole-rat(101706849) tetratricopeptide repeat domain 16
Domestic Rabbit(100356915) tetratricopeptide repeat domain 16
chicken(771595) tetratricopeptide repeat domain 16
chicken(101750262) tetratricopeptide repeat domain 16
domestic cat(101097524) tetratricopeptide repeat domain 16
Horse(100070471) tetratricopeptide repeat domain 16
dog(100685695) tetratricopeptide repeat domain 16
chicken(101668826) tetratricopeptide repeat domain 16
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177384 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177384 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177384 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144965 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144965 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144965 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU051681 MISSION® esiRNA esiRNA targeting mouse Ttc16 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144965 Rosetta Predictions human pricing
XM_345338 Rosetta Predictions rat pricing
NM_177384 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364750 predicted 1486
2 SASI_Hs01_00161629 predicted 2051
3 SASI_Hs01_00161630 predicted 2468
4 SASI_Hs01_00161631 predicted 2040
5 SASI_Hs01_00161634 predicted 2155
6 SASI_Hs02_00364751 predicted 2510
7 SASI_Hs01_00161635 predicted 468
8 SASI_Hs01_00161636 predicted 1498
9 SASI_Hs01_00161637 predicted 1156
10 SASI_Hs01_00161638 predicted 567
11 SASI_Hs01_00161632 predicted 357
12 SASI_Hs01_00161633 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345338 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00184287 predicted 654
2 SASI_Rn01_00184288 predicted 542
3 SASI_Rn01_00184289 predicted 2072
4 SASI_Rn01_00184290 predicted 2035
5 SASI_Rn01_00184291 predicted 779
6 SASI_Rn01_00184292 predicted 292
7 SASI_Rn01_00184293 predicted 313
8 SASI_Rn01_00184294 predicted 219
9 SASI_Rn01_00184295 predicted 1978
10 SASI_Rn01_00184296 predicted 806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177384 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132529 predicted 2215
2 SASI_Mm01_00132530 predicted 1947
3 SASI_Mm01_00132531 predicted 1888
4 SASI_Mm01_00132533 predicted 1926
5 SASI_Mm01_00132534 predicted 2491
6 SASI_Mm01_00132535 predicted 1449
7 SASI_Mm01_00132537 predicted 1310
8 SASI_Mm01_00132538 predicted 2698
9 SASI_Mm02_00347560 predicted 1195
10 SASI_Mm02_00347561 predicted 1771
11 SASI_Mm01_00132532 predicted 2245
12 SASI_Mm01_00132536 predicted 555
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177384
TTC16 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 16
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177384.1-1195s1c1
Sequence:CCGGGAAGTGCATCAACTGTGCCATCTCGAGATGGCACAGTTGATGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177384.1-1828s1c1
Sequence:CCGGCCTCTTTCCTAGCATGACTGTCTCGAGACAGTCATGCTAGGAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177384.1-757s1c1
Sequence:CCGGCCCAGGGAATAACAAGTACCTCTCGAGAGGTACTTGTTATTCCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177384.1-1465s1c1
Sequence:CCGGGCAGAATGAGAAGGGCTTGTACTCGAGTACAAGCCCTTCTCATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177384.1-1814s1c1
Sequence:CCGGGCAGTGATGAACACCCTCTTTCTCGAGAAAGAGGGTGTTCATCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177384.1-1372s1c1
Sequence:CCGGGCTGCTGACTTACAATGACTTCTCGAGAAGTCATTGTAAGTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177384.1-657s1c1
Sequence:CCGGCCAAACTGGTAGACTTCTATGCTCGAGCATAGAAGTCTACCAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177384
TTC16 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 16
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177384.1-1195s1c1
Sequence:CCGGGAAGTGCATCAACTGTGCCATCTCGAGATGGCACAGTTGATGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177384.1-1828s1c1
Sequence:CCGGCCTCTTTCCTAGCATGACTGTCTCGAGACAGTCATGCTAGGAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177384.1-757s1c1
Sequence:CCGGCCCAGGGAATAACAAGTACCTCTCGAGAGGTACTTGTTATTCCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177384.1-1465s1c1
Sequence:CCGGGCAGAATGAGAAGGGCTTGTACTCGAGTACAAGCCCTTCTCATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177384.1-1814s1c1
Sequence:CCGGGCAGTGATGAACACCCTCTTTCTCGAGAAAGAGGGTGTTCATCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177384.1-1372s1c1
Sequence:CCGGGCTGCTGACTTACAATGACTTCTCGAGAAGTCATTGTAAGTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177384.1-657s1c1
Sequence:CCGGCCAAACTGGTAGACTTCTATGCTCGAGCATAGAAGTCTACCAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177384
TTC16 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 16
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177384.1-1195s1c1
Sequence:CCGGGAAGTGCATCAACTGTGCCATCTCGAGATGGCACAGTTGATGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177384.1-1828s1c1
Sequence:CCGGCCTCTTTCCTAGCATGACTGTCTCGAGACAGTCATGCTAGGAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177384.1-757s1c1
Sequence:CCGGCCCAGGGAATAACAAGTACCTCTCGAGAGGTACTTGTTATTCCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177384.1-1465s1c1
Sequence:CCGGGCAGAATGAGAAGGGCTTGTACTCGAGTACAAGCCCTTCTCATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177384.1-1814s1c1
Sequence:CCGGGCAGTGATGAACACCCTCTTTCTCGAGAAAGAGGGTGTTCATCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177384.1-1372s1c1
Sequence:CCGGGCTGCTGACTTACAATGACTTCTCGAGAAGTCATTGTAAGTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177384.1-657s1c1
Sequence:CCGGCCAAACTGGTAGACTTCTATGCTCGAGCATAGAAGTCTACCAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144965
TTC16 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 16
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144965.1-347s1c1
Sequence:CCGGCTGGTGGACTTCTATGCCTTACTCGAGTAAGGCATAGAAGTCCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144965.1-241s1c1
Sequence:CCGGCCTCAAAGTCAGGGAATACTACTCGAGTAGTATTCCCTGACTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144965.1-1153s1c1
Sequence:CCGGGCAGGAGAAAGGACTCTACATCTCGAGATGTAGAGTCCTTTCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144965.1-2481s1c1
Sequence:CCGGCTGAGGCTTTCTATGACTCAACTCGAGTTGAGTCATAGAAAGCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144965.1-889s21c1
Sequence:CCGGCAACCGTGCCATCGAGAACAACTCGAGTTGTTCTCGATGGCACGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144965
TTC16 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 16
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144965.1-347s1c1
Sequence:CCGGCTGGTGGACTTCTATGCCTTACTCGAGTAAGGCATAGAAGTCCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144965.1-241s1c1
Sequence:CCGGCCTCAAAGTCAGGGAATACTACTCGAGTAGTATTCCCTGACTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144965.1-1153s1c1
Sequence:CCGGGCAGGAGAAAGGACTCTACATCTCGAGATGTAGAGTCCTTTCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144965.1-2481s1c1
Sequence:CCGGCTGAGGCTTTCTATGACTCAACTCGAGTTGAGTCATAGAAAGCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144965.1-889s21c1
Sequence:CCGGCAACCGTGCCATCGAGAACAACTCGAGTTGTTCTCGATGGCACGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144965
TTC16 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 16
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144965.1-347s1c1
Sequence:CCGGCTGGTGGACTTCTATGCCTTACTCGAGTAAGGCATAGAAGTCCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144965.1-241s1c1
Sequence:CCGGCCTCAAAGTCAGGGAATACTACTCGAGTAGTATTCCCTGACTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144965.1-1153s1c1
Sequence:CCGGGCAGGAGAAAGGACTCTACATCTCGAGATGTAGAGTCCTTTCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144965.1-2481s1c1
Sequence:CCGGCTGAGGCTTTCTATGACTCAACTCGAGTTGAGTCATAGAAAGCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144965.1-889s21c1
Sequence:CCGGCAACCGTGCCATCGAGAACAACTCGAGTTGTTCTCGATGGCACGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks