EMAIL THIS PAGE TO A FRIEND

TTC17

tetratricopeptide repeat domain 17

UniProtKB ID: Q96AE7
Gene ID:
Mouse(74569) tetratricopeptide repeat domain 17
Rat(311224) tetratricopeptide repeat domain 17
Zebrafish(569538) tetratricopeptide repeat domain 17
Horse(100055237) tetratricopeptide repeat domain 17
domestic cat(101082342) tetratricopeptide repeat domain 17
dog(475940) tetratricopeptide repeat domain 17
chicken(423167) tetratricopeptide repeat domain 17
Domestic Rabbit(100346174) tetratricopeptide repeat domain 17
naked mole-rat(101719038) tetratricopeptide repeat domain 17
domestic guinea pig(100724269) tetratricopeptide repeat domain 17
cow(512239) tetratricopeptide repeat domain 17
sheep(101109386) tetratricopeptide repeat domain 17
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018259 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018259 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018259 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183106 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183106 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183106 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018259 Rosetta Predictions human pricing
NM_001107752 Rosetta Predictions rat pricing
NM_183106 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018259 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351620 predicted 600
2 SASI_Hs01_00125191 predicted 2143
3 SASI_Hs01_00125192 predicted 624
4 SASI_Hs02_00351621 predicted 3136
5 SASI_Hs01_00125194 predicted 1011
6 SASI_Hs01_00125196 predicted 1404
7 SASI_Hs01_00125197 predicted 1062
8 SASI_Hs02_00351622 predicted 1519
9 SASI_Hs01_00125198 predicted 3210
10 SASI_Hs01_00125199 predicted 3001
11 SASI_Hs01_00125193 predicted 1871
12 SASI_Hs01_00125195 predicted 2355
13 SASI_Hs01_00125200 predicted 2520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107752 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231915 predicted 583
2 SASI_Rn02_00231916 predicted 1367
3 SASI_Rn02_00231917 predicted 997
4 SASI_Rn02_00231918 predicted 1347
5 SASI_Rn02_00231919 predicted 1464
6 SASI_Rn02_00231920 predicted 582
7 SASI_Rn02_00231921 predicted 613
8 SASI_Rn02_00231922 predicted 1687
9 SASI_Rn02_00231923 predicted 797
10 SASI_Rn02_00231924 predicted 531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183106 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350088 predicted 1957
2 SASI_Mm02_00350089 predicted 1618
3 SASI_Mm02_00350090 predicted 614
4 SASI_Mm02_00350091 predicted 635
5 SASI_Mm02_00350092 predicted 3186
6 SASI_Mm02_00350093 predicted 820
7 SASI_Mm02_00350094 predicted 741
8 SASI_Mm02_00350095 predicted 1341
9 SASI_Mm02_00350096 predicted 1003
10 SASI_Mm02_00350097 predicted 3540
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018259
VALIDATED
TTC17 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 17
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018259.4-201s21c1
Sequence:CCGGCCTCATGACCTAGTCATATTACTCGAGTAATATGACTAGGTCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018259.4-2034s21c1
Sequence:CCGGGCCACTAAGCTGCTACTTCAACTCGAGTTGAAGTAGCAGCTTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_018259.4-1489s21c1
Sequence:CCGGATAGGGACAAACAGCATATTCCTCGAGGAATATGCTGTTTGTCCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018259.4-504s21c1
Sequence:CCGGCTAGAACTTCCATATAGTATACTCGAGTATACTATATGGAAGTTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018259.4-992s21c1
Sequence:CCGGTGGGTTTGAGCAAGCTATAAACTCGAGTTTATAGCTTGCTCAAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018259.3-2539s1c1
Sequence:CCGGCCAGGTCAAACGTGTAAAGAACTCGAGTTCTTTACACGTTTGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018259.3-586s1c1
Sequence:CCGGGCTACCTAAAGAAGACCCAATCTCGAGATTGGGTCTTCTTTAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018259.3-1084s1c1
Sequence:CCGGCCAGCGAACACTGAATGAGTTCTCGAGAACTCATTCAGTGTTCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018259.3-202s1c1
Sequence:CCGGGCATCCTCATGACCTAGTCATCTCGAGATGACTAGGTCATGAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018259.3-175s1c1
Sequence:CCGGGCAGGTGGATTCACCAATGAACTCGAGTTCATTGGTGAATCCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018259.3-2039s1c1
Sequence:CCGGGCCACTAAGCTGCTACTTCAACTCGAGTTGAAGTAGCAGCTTAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018259.3-3021s1c1
Sequence:CCGGGCACCCGAATTGCCAAAGTTTCTCGAGAAACTTTGGCAATTCGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018259
VALIDATED
TTC17 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 17
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018259.4-201s21c1
Sequence:CCGGCCTCATGACCTAGTCATATTACTCGAGTAATATGACTAGGTCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018259.4-2034s21c1
Sequence:CCGGGCCACTAAGCTGCTACTTCAACTCGAGTTGAAGTAGCAGCTTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_018259.4-1489s21c1
Sequence:CCGGATAGGGACAAACAGCATATTCCTCGAGGAATATGCTGTTTGTCCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018259.4-504s21c1
Sequence:CCGGCTAGAACTTCCATATAGTATACTCGAGTATACTATATGGAAGTTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018259.4-992s21c1
Sequence:CCGGTGGGTTTGAGCAAGCTATAAACTCGAGTTTATAGCTTGCTCAAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018259.3-2539s1c1
Sequence:CCGGCCAGGTCAAACGTGTAAAGAACTCGAGTTCTTTACACGTTTGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018259.3-586s1c1
Sequence:CCGGGCTACCTAAAGAAGACCCAATCTCGAGATTGGGTCTTCTTTAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018259.3-1084s1c1
Sequence:CCGGCCAGCGAACACTGAATGAGTTCTCGAGAACTCATTCAGTGTTCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018259.3-202s1c1
Sequence:CCGGGCATCCTCATGACCTAGTCATCTCGAGATGACTAGGTCATGAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018259.3-175s1c1
Sequence:CCGGGCAGGTGGATTCACCAATGAACTCGAGTTCATTGGTGAATCCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018259.3-2039s1c1
Sequence:CCGGGCCACTAAGCTGCTACTTCAACTCGAGTTGAAGTAGCAGCTTAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018259.3-3021s1c1
Sequence:CCGGGCACCCGAATTGCCAAAGTTTCTCGAGAAACTTTGGCAATTCGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018259
VALIDATED
TTC17 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 17
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018259.4-201s21c1
Sequence:CCGGCCTCATGACCTAGTCATATTACTCGAGTAATATGACTAGGTCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018259.4-2034s21c1
Sequence:CCGGGCCACTAAGCTGCTACTTCAACTCGAGTTGAAGTAGCAGCTTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_018259.4-1489s21c1
Sequence:CCGGATAGGGACAAACAGCATATTCCTCGAGGAATATGCTGTTTGTCCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018259.4-504s21c1
Sequence:CCGGCTAGAACTTCCATATAGTATACTCGAGTATACTATATGGAAGTTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018259.4-992s21c1
Sequence:CCGGTGGGTTTGAGCAAGCTATAAACTCGAGTTTATAGCTTGCTCAAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018259.3-2539s1c1
Sequence:CCGGCCAGGTCAAACGTGTAAAGAACTCGAGTTCTTTACACGTTTGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018259.3-586s1c1
Sequence:CCGGGCTACCTAAAGAAGACCCAATCTCGAGATTGGGTCTTCTTTAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018259.3-1084s1c1
Sequence:CCGGCCAGCGAACACTGAATGAGTTCTCGAGAACTCATTCAGTGTTCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018259.3-202s1c1
Sequence:CCGGGCATCCTCATGACCTAGTCATCTCGAGATGACTAGGTCATGAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018259.3-175s1c1
Sequence:CCGGGCAGGTGGATTCACCAATGAACTCGAGTTCATTGGTGAATCCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018259.3-2039s1c1
Sequence:CCGGGCCACTAAGCTGCTACTTCAACTCGAGTTGAAGTAGCAGCTTAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018259.3-3021s1c1
Sequence:CCGGGCACCCGAATTGCCAAAGTTTCTCGAGAAACTTTGGCAATTCGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183106
VALIDATED
TTC17 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 17
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183106.2-808s21c1
Sequence:CCGGGACATTGCTCTGGTCAATTTGCTCGAGCAAATTGACCAGAGCAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183106.2-1482s21c1
Sequence:CCGGCCGTGACTCTGATGCGTATAGCTCGAGCTATACGCATCAGAGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183106.2-514s21c1
Sequence:CCGGCTAGAGCTTCCATATAGTATACTCGAGTATACTATATGGAAGCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183106.2-4285s21c1
Sequence:CCGGCAATATGTTGAAGTCCTATATCTCGAGATATAGGACTTCAACATATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183106.2-1002s21c1
Sequence:CCGGTGGGTTTGAGCAAGCTATAAACTCGAGTTTATAGCTTGCTCAAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183106
VALIDATED
TTC17 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 17
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183106.2-808s21c1
Sequence:CCGGGACATTGCTCTGGTCAATTTGCTCGAGCAAATTGACCAGAGCAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183106.2-1482s21c1
Sequence:CCGGCCGTGACTCTGATGCGTATAGCTCGAGCTATACGCATCAGAGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183106.2-514s21c1
Sequence:CCGGCTAGAGCTTCCATATAGTATACTCGAGTATACTATATGGAAGCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183106.2-4285s21c1
Sequence:CCGGCAATATGTTGAAGTCCTATATCTCGAGATATAGGACTTCAACATATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183106.2-1002s21c1
Sequence:CCGGTGGGTTTGAGCAAGCTATAAACTCGAGTTTATAGCTTGCTCAAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183106
VALIDATED
TTC17 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 17
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183106.2-808s21c1
Sequence:CCGGGACATTGCTCTGGTCAATTTGCTCGAGCAAATTGACCAGAGCAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183106.2-1482s21c1
Sequence:CCGGCCGTGACTCTGATGCGTATAGCTCGAGCTATACGCATCAGAGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183106.2-514s21c1
Sequence:CCGGCTAGAGCTTCCATATAGTATACTCGAGTATACTATATGGAAGCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183106.2-4285s21c1
Sequence:CCGGCAATATGTTGAAGTCCTATATCTCGAGATATAGGACTTCAACATATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183106.2-1002s21c1
Sequence:CCGGTGGGTTTGAGCAAGCTATAAACTCGAGTTTATAGCTTGCTCAAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks