EMAIL THIS PAGE TO A FRIEND

TTC18

tetratricopeptide repeat domain 18

Gene ID:
Mouse(76670) tetratricopeptide repeat domain 18
Rat(361006) tetratricopeptide repeat domain 18
cow(529891) tetratricopeptide repeat domain 18
sheep(101118160) tetratricopeptide repeat domain 18
domestic guinea pig(100718417) tetratricopeptide repeat domain 18
naked mole-rat(101706606) tetratricopeptide repeat domain 18
Domestic Rabbit(100338836) tetratricopeptide repeat domain 18
chicken(769473) tetratricopeptide repeat domain 18
dog(479245) tetratricopeptide repeat domain 18
domestic cat(101085661) tetratricopeptide repeat domain 18
Horse(100063877) tetratricopeptide repeat domain 18
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145170 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145170 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145170 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001163639 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163639 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163639 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145170 Rosetta Predictions human pricing
NM_001108370 Rosetta Predictions rat pricing
XM_127606 Rosetta Predictions mouse pricing
XM_895877 Rosetta Predictions mouse pricing
XM_980494 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064891 predicted 825
2 SASI_Hs01_00064892 predicted 3300
3 SASI_Hs02_00365022 predicted 463
4 SASI_Hs01_00064893 predicted 3173
5 SASI_Hs02_00365023 predicted 1158
6 SASI_Hs01_00064894 predicted 856
7 SASI_Hs01_00064895 predicted 3344
8 SASI_Hs01_00064896 predicted 3373
9 SASI_Hs01_00064897 predicted 920
10 SASI_Hs02_00365024 predicted 1777
11 SASI_Hs01_00064890 predicted 2305
12 SASI_Hs01_00064898 predicted 3083
13 SASI_Hs01_00064899 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108370 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237999 predicted 367
2 SASI_Rn02_00238000 predicted 359
3 SASI_Rn02_00238001 predicted 415
4 SASI_Rn02_00238002 predicted 849
5 SASI_Rn02_00238003 predicted 736
6 SASI_Rn02_00238004 predicted 578
7 SASI_Rn02_00238005 predicted 621
8 SASI_Rn02_00238006 predicted 1184
9 SASI_Rn02_00238007 predicted 697
10 SASI_Rn02_00238008 predicted 847
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_127606 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215494 predicted 1861
2 SASI_Mm02_00424233 predicted 2067
3 SASI_Mm01_00215495 predicted 1612
4 SASI_Mm01_00215496 predicted 510
5 SASI_Mm01_00215497 predicted 358
6 SASI_Mm01_00215498 predicted 774
7 SASI_Mm01_00215499 predicted 226
8 SASI_Mm01_00215500 predicted 2287
9 SASI_Mm01_00215501 predicted 952
10 SASI_Mm01_00215502 predicted 1583
11 SASI_Mm01_00215493 predicted 2166
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895877 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246683 predicted 345
2 SASI_Mm01_00246684 predicted 97
3 SASI_Mm01_00246685 predicted 122
4 SASI_Mm01_00246686 predicted 237
5 SASI_Mm01_00246687 predicted 316
6 SASI_Mm01_00246688 predicted 254
7 SASI_Mm01_00246689 predicted 90
8 SASI_Mm01_00246690 predicted 247
9 SASI_Mm01_00246691 predicted 322
10 SASI_Mm01_00246692 predicted 126
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_980494 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00447291 predicted 1802
2 SASI_Mm02_00447292 predicted 1551
3 SASI_Mm02_00447293 predicted 449
4 SASI_Mm02_00447294 predicted 295
5 SASI_Mm02_00447295 predicted 2931
6 SASI_Mm02_00447296 predicted 712
7 SASI_Mm02_00447297 predicted 2227
8 SASI_Mm02_00447298 predicted 889
9 SASI_Mm02_00447299 predicted 2560
10 SASI_Mm02_00447300 predicted 1531
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145170
TTC18 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 18
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145170.2-2253s1c1
Sequence:CCGGGCTGTCCTGTTGGAGAACTATCTCGAGATAGTTCTCCAACAGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145170.2-517s1c1
Sequence:CCGGCCTTAGAAACTCCTAGATCAACTCGAGTTGATCTAGGAGTTTCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145170.2-2049s1c1
Sequence:CCGGGCAGAAGTCAATGAGAACTTTCTCGAGAAAGTTCTCATTGACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145170.2-2391s1c1
Sequence:CCGGGCATTTCATGAGGCCTCCAAACTCGAGTTTGGAGGCCTCATGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145170.2-2153s1c1
Sequence:CCGGCCTCCTAACTGAAGACAACATCTCGAGATGTTGTCTTCAGTTAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145170.2-909s1c1
Sequence:CCGGGACAGCGAATTTAGGAATCAACTCGAGTTGATTCCTAAATTCGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145170.2-1051s1c1
Sequence:CCGGCAAGAGTTCCTCTGGTCACTACTCGAGTAGTGACCAGAGGAACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145170.3-1952s21c1
Sequence:CCGGCAGATGCATGTAGCCCTAAACCTCGAGGTTTAGGGCTACATGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145170.3-1996s21c1
Sequence:CCGGAGGCACTGTTGCAACCATTTACTCGAGTAAATGGTTGCAACAGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145170.3-1409s21c1
Sequence:CCGGGATGTGCAGGCACCTAGTATACTCGAGTATACTAGGTGCCTGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145170
TTC18 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 18
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145170.2-2253s1c1
Sequence:CCGGGCTGTCCTGTTGGAGAACTATCTCGAGATAGTTCTCCAACAGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145170.2-517s1c1
Sequence:CCGGCCTTAGAAACTCCTAGATCAACTCGAGTTGATCTAGGAGTTTCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145170.2-2049s1c1
Sequence:CCGGGCAGAAGTCAATGAGAACTTTCTCGAGAAAGTTCTCATTGACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145170.2-2391s1c1
Sequence:CCGGGCATTTCATGAGGCCTCCAAACTCGAGTTTGGAGGCCTCATGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145170.2-2153s1c1
Sequence:CCGGCCTCCTAACTGAAGACAACATCTCGAGATGTTGTCTTCAGTTAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145170.2-909s1c1
Sequence:CCGGGACAGCGAATTTAGGAATCAACTCGAGTTGATTCCTAAATTCGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145170.2-1051s1c1
Sequence:CCGGCAAGAGTTCCTCTGGTCACTACTCGAGTAGTGACCAGAGGAACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145170.3-1952s21c1
Sequence:CCGGCAGATGCATGTAGCCCTAAACCTCGAGGTTTAGGGCTACATGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145170.3-1996s21c1
Sequence:CCGGAGGCACTGTTGCAACCATTTACTCGAGTAAATGGTTGCAACAGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145170.3-1409s21c1
Sequence:CCGGGATGTGCAGGCACCTAGTATACTCGAGTATACTAGGTGCCTGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145170
TTC18 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 18
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145170.2-2253s1c1
Sequence:CCGGGCTGTCCTGTTGGAGAACTATCTCGAGATAGTTCTCCAACAGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145170.2-517s1c1
Sequence:CCGGCCTTAGAAACTCCTAGATCAACTCGAGTTGATCTAGGAGTTTCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145170.2-2049s1c1
Sequence:CCGGGCAGAAGTCAATGAGAACTTTCTCGAGAAAGTTCTCATTGACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145170.2-2391s1c1
Sequence:CCGGGCATTTCATGAGGCCTCCAAACTCGAGTTTGGAGGCCTCATGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145170.2-2153s1c1
Sequence:CCGGCCTCCTAACTGAAGACAACATCTCGAGATGTTGTCTTCAGTTAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145170.2-909s1c1
Sequence:CCGGGACAGCGAATTTAGGAATCAACTCGAGTTGATTCCTAAATTCGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145170.2-1051s1c1
Sequence:CCGGCAAGAGTTCCTCTGGTCACTACTCGAGTAGTGACCAGAGGAACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145170.3-1952s21c1
Sequence:CCGGCAGATGCATGTAGCCCTAAACCTCGAGGTTTAGGGCTACATGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145170.3-1996s21c1
Sequence:CCGGAGGCACTGTTGCAACCATTTACTCGAGTAAATGGTTGCAACAGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145170.3-1409s21c1
Sequence:CCGGGATGTGCAGGCACCTAGTATACTCGAGTATACTAGGTGCCTGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163639
TTC18 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 18
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163639.1-168s21c1
Sequence:CCGGTGTGACAAATGGATATGATTTCTCGAGAAATCATATCCATTTGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163639.1-1413s21c1
Sequence:CCGGGCTGCAAGCGCCTAGTATAAACTCGAGTTTATACTAGGCGCTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163639.1-2699s21c1
Sequence:CCGGCTCCTACCCAGCACGTTATTGCTCGAGCAATAACGTGCTGGGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163639.1-562s21c1
Sequence:CCGGAGTCTTGATGTGAAGGTATTTCTCGAGAAATACCTTCACATCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163639.1-2830s21c1
Sequence:CCGGGGACCCAGTTGTGAGTATTATCTCGAGATAATACTCACAACTGGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163639
TTC18 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 18
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163639.1-168s21c1
Sequence:CCGGTGTGACAAATGGATATGATTTCTCGAGAAATCATATCCATTTGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163639.1-1413s21c1
Sequence:CCGGGCTGCAAGCGCCTAGTATAAACTCGAGTTTATACTAGGCGCTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163639.1-2699s21c1
Sequence:CCGGCTCCTACCCAGCACGTTATTGCTCGAGCAATAACGTGCTGGGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163639.1-562s21c1
Sequence:CCGGAGTCTTGATGTGAAGGTATTTCTCGAGAAATACCTTCACATCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163639.1-2830s21c1
Sequence:CCGGGGACCCAGTTGTGAGTATTATCTCGAGATAATACTCACAACTGGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163639
TTC18 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 18
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163639.1-168s21c1
Sequence:CCGGTGTGACAAATGGATATGATTTCTCGAGAAATCATATCCATTTGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163639.1-1413s21c1
Sequence:CCGGGCTGCAAGCGCCTAGTATAAACTCGAGTTTATACTAGGCGCTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163639.1-2699s21c1
Sequence:CCGGCTCCTACCCAGCACGTTATTGCTCGAGCAATAACGTGCTGGGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163639.1-562s21c1
Sequence:CCGGAGTCTTGATGTGAAGGTATTTCTCGAGAAATACCTTCACATCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163639.1-2830s21c1
Sequence:CCGGGGACCCAGTTGTGAGTATTATCTCGAGATAATACTCACAACTGGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks