EMAIL THIS PAGE TO A FRIEND

TTC19

tetratricopeptide repeat domain 19

Synonyms: 2010204O13Rik MC3DN2
Gene ID:
Human(54902) Summary: This gene encodes a protein with a tetratricopeptide repeat (TPR) domain containing several TPRs of about 34 aa each. These repeats are found in a variety of organisms including bacteria, fungi and plants, and are involved in a variety of functions including protein-protein interactions. This protein is embedded in the inner mitochondrial membrane and is involved in the formation of the mitochondrial respiratory chain III. It has also been suggested that this protein plays a role in cytokinesis. Mutations in this gene cause mitochondrial complex III deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2012]
Mouse(72795) tetratricopeptide repeat domain 19
Rat(691506) tetratricopeptide repeat domain 19
fruit fly(35172) Tetratricopeptide repeat domain 19
Zebrafish(564788) tetratricopeptide repeat domain 19
dog(479516) tetratricopeptide repeat domain 19
domestic cat(101083219) tetratricopeptide repeat domain 19
chicken(417597) tetratricopeptide repeat domain 19
naked mole-rat(101708781) tetratricopeptide repeat domain 19
domestic guinea pig(100721871) tetratricopeptide repeat domain 19
cow(789903) tetratricopeptide repeat domain 19
sheep(101107453) tetratricopeptide repeat domain 19
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017775 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017775 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017775 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028360 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028360 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028360 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU022771 MISSION® esiRNA esiRNA human TTC19 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017775 Rosetta Predictions human pricing
NM_001109644 Rosetta Predictions rat pricing
NM_028360 Rosetta Predictions mouse pricing
NM_029704 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017775 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103941 predicted 1506
2 SASI_Hs01_00103942 predicted 894
3 SASI_Hs01_00103943 predicted 1295
4 SASI_Hs01_00103944 predicted 1324
5 SASI_Hs01_00103945 predicted 762
6 SASI_Hs01_00103946 predicted 1266
7 SASI_Hs02_00350614 predicted 889
8 SASI_Hs01_00103949 predicted 1068
9 SASI_Hs01_00103950 predicted 1561
10 SASI_Hs02_00350615 predicted 1255
11 SASI_Hs01_00103947 predicted 1372
12 SASI_Hs01_00103948 predicted 1319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109644 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250372 predicted 313
2 SASI_Rn02_00250373 predicted 1181
3 SASI_Rn02_00250374 predicted 1194
4 SASI_Rn02_00250375 predicted 417
5 SASI_Rn02_00250376 predicted 1135
6 SASI_Rn02_00250377 predicted 1049
7 SASI_Rn02_00250378 predicted 567
8 SASI_Rn02_00250379 predicted 1148
9 SASI_Rn02_00250380 predicted 617
10 SASI_Rn02_00250381 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028360 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115285 predicted 1225
2 SASI_Mm02_00333736 predicted 885
3 SASI_Mm01_00115286 predicted 395
4 SASI_Mm01_00115288 predicted 575
5 SASI_Mm01_00115289 predicted 847
6 SASI_Mm01_00115290 predicted 552
7 SASI_Mm02_00333737 predicted 966
8 SASI_Mm01_00115291 predicted 611
9 SASI_Mm01_00115292 predicted 1233
10 SASI_Mm01_00115293 predicted 662
11 SASI_Mm01_00115287 predicted 1046
12 SASI_Mm01_00115294 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029704 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335752 predicted 741
2 SASI_Mm02_00335753 predicted 718
3 SASI_Mm02_00335754 predicted 728
4 SASI_Mm02_00335755 predicted 793
5 SASI_Mm02_00335756 predicted 794
6 SASI_Mm02_00335757 predicted 753
7 SASI_Mm02_00335758 predicted 631
8 SASI_Mm02_00335759 predicted 629
9 SASI_Mm02_00335760 predicted 724
10 SASI_Mm02_00335761 predicted 738
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017775
VALIDATED
TTC19 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 19
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_017775.2-1144s21c1
Sequence:CCGGCAGGCACAAAGGATGTATGAACTCGAGTTCATACATCCTTTGTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_017775.2-1260s21c1
Sequence:CCGGCCGCTTTGATGAGGCCTATATCTCGAGATATAGGCCTCATCAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_017775.2-1306s21c1
Sequence:CCGGGCAAGACAGATAAATCATCCTCTCGAGAGGATGATTTATCTGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_017775.2-2529s21c1
Sequence:CCGGGCTGTGCTGAAAGAGCTTTATCTCGAGATAAAGCTCTTTCAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168324    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017775.2-2529s1c1
Sequence:CCGGGCTGTGCTGAAAGAGCTTTATCTCGAGATAAAGCTCTTTCAGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017775.2-1306s1c1
Sequence:CCGGGCAAGACAGATAAATCATCCTCTCGAGAGGATGATTTATCTGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017775.2-1144s1c1
Sequence:CCGGCAGGCACAAAGGATGTATGAACTCGAGTTCATACATCCTTTGTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017775.2-862s1c1
Sequence:CCGGGCAACAATGAGTTACCTCCTTCTCGAGAAGGAGGTAACTCATTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017775
VALIDATED
TTC19 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 19
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_017775.2-1144s21c1
Sequence:CCGGCAGGCACAAAGGATGTATGAACTCGAGTTCATACATCCTTTGTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_017775.2-1260s21c1
Sequence:CCGGCCGCTTTGATGAGGCCTATATCTCGAGATATAGGCCTCATCAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_017775.2-1306s21c1
Sequence:CCGGGCAAGACAGATAAATCATCCTCTCGAGAGGATGATTTATCTGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_017775.2-2529s21c1
Sequence:CCGGGCTGTGCTGAAAGAGCTTTATCTCGAGATAAAGCTCTTTCAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168324    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017775.2-2529s1c1
Sequence:CCGGGCTGTGCTGAAAGAGCTTTATCTCGAGATAAAGCTCTTTCAGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017775.2-1306s1c1
Sequence:CCGGGCAAGACAGATAAATCATCCTCTCGAGAGGATGATTTATCTGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017775.2-1144s1c1
Sequence:CCGGCAGGCACAAAGGATGTATGAACTCGAGTTCATACATCCTTTGTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017775.2-862s1c1
Sequence:CCGGGCAACAATGAGTTACCTCCTTCTCGAGAAGGAGGTAACTCATTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017775
VALIDATED
TTC19 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 19
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_017775.2-1144s21c1
Sequence:CCGGCAGGCACAAAGGATGTATGAACTCGAGTTCATACATCCTTTGTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_017775.2-1260s21c1
Sequence:CCGGCCGCTTTGATGAGGCCTATATCTCGAGATATAGGCCTCATCAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_017775.2-1306s21c1
Sequence:CCGGGCAAGACAGATAAATCATCCTCTCGAGAGGATGATTTATCTGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_017775.2-2529s21c1
Sequence:CCGGGCTGTGCTGAAAGAGCTTTATCTCGAGATAAAGCTCTTTCAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168324    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017775.2-2529s1c1
Sequence:CCGGGCTGTGCTGAAAGAGCTTTATCTCGAGATAAAGCTCTTTCAGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017775.2-1306s1c1
Sequence:CCGGGCAAGACAGATAAATCATCCTCTCGAGAGGATGATTTATCTGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017775.2-1144s1c1
Sequence:CCGGCAGGCACAAAGGATGTATGAACTCGAGTTCATACATCCTTTGTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017775.2-862s1c1
Sequence:CCGGGCAACAATGAGTTACCTCCTTCTCGAGAAGGAGGTAACTCATTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028360
TTC19 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 19
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028360.2-429s21c1
Sequence:CCGGATGACCTGATGGCCAACTTAGCTCGAGCTAAGTTGGCCATCAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028360.2-664s1c1
Sequence:CCGGGGAATTAGCAGAAGATATTATCTCGAGATAATATCTTCTGCTAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028360.2-929s1c1
Sequence:CCGGGATCTGGCAAGAGAGATAAATCTCGAGATTTATCTCTCTTGCCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215835    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028360.2-2597s1c1
Sequence:CCGGCATTCGTTTGCACTATTATAACTCGAGTTATAATAGTGCAAACGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028360.2-892s21c1
Sequence:CCGGCTTTGATGATGCCTACATTTACTCGAGTAAATGTAGGCATCATCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028360.2-663s21c1
Sequence:CCGGAGGAATTAGCAGAAGATATTACTCGAGTAATATCTTCTGCTAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028360.2-2595s21c1
Sequence:CCGGAGCATTCGTTTGCACTATTATCTCGAGATAATAGTGCAAACGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028360.2-929s21c1
Sequence:CCGGGATCTGGCAAGAGAGATAAATCTCGAGATTTATCTCTCTTGCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028360.1-534s1c1
Sequence:CCGGGCTGCTCAGAATAAACAGGAACTCGAGTTCCTGTTTATTCTGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028360
TTC19 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 19
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028360.2-429s21c1
Sequence:CCGGATGACCTGATGGCCAACTTAGCTCGAGCTAAGTTGGCCATCAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028360.2-664s1c1
Sequence:CCGGGGAATTAGCAGAAGATATTATCTCGAGATAATATCTTCTGCTAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028360.2-929s1c1
Sequence:CCGGGATCTGGCAAGAGAGATAAATCTCGAGATTTATCTCTCTTGCCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215835    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028360.2-2597s1c1
Sequence:CCGGCATTCGTTTGCACTATTATAACTCGAGTTATAATAGTGCAAACGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028360.2-892s21c1
Sequence:CCGGCTTTGATGATGCCTACATTTACTCGAGTAAATGTAGGCATCATCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028360.2-663s21c1
Sequence:CCGGAGGAATTAGCAGAAGATATTACTCGAGTAATATCTTCTGCTAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028360.2-2595s21c1
Sequence:CCGGAGCATTCGTTTGCACTATTATCTCGAGATAATAGTGCAAACGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028360.2-929s21c1
Sequence:CCGGGATCTGGCAAGAGAGATAAATCTCGAGATTTATCTCTCTTGCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028360.1-534s1c1
Sequence:CCGGGCTGCTCAGAATAAACAGGAACTCGAGTTCCTGTTTATTCTGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028360
TTC19 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 19
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028360.2-429s21c1
Sequence:CCGGATGACCTGATGGCCAACTTAGCTCGAGCTAAGTTGGCCATCAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028360.2-664s1c1
Sequence:CCGGGGAATTAGCAGAAGATATTATCTCGAGATAATATCTTCTGCTAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028360.2-929s1c1
Sequence:CCGGGATCTGGCAAGAGAGATAAATCTCGAGATTTATCTCTCTTGCCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215835    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028360.2-2597s1c1
Sequence:CCGGCATTCGTTTGCACTATTATAACTCGAGTTATAATAGTGCAAACGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028360.2-892s21c1
Sequence:CCGGCTTTGATGATGCCTACATTTACTCGAGTAAATGTAGGCATCATCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028360.2-663s21c1
Sequence:CCGGAGGAATTAGCAGAAGATATTACTCGAGTAATATCTTCTGCTAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028360.2-2595s21c1
Sequence:CCGGAGCATTCGTTTGCACTATTATCTCGAGATAATAGTGCAAACGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028360.2-929s21c1
Sequence:CCGGGATCTGGCAAGAGAGATAAATCTCGAGATTTATCTCTCTTGCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028360.1-534s1c1
Sequence:CCGGGCTGCTCAGAATAAACAGGAACTCGAGTTCCTGTTTATTCTGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks