EMAIL THIS PAGE TO A FRIEND

TTC1

tetratricopeptide repeat domain 1

Synonyms: TPR1
UniProtKB ID: Q99614, B2RCT2, D3DQJ8, Q9BVT3
Gene ID:
Mouse(66827) tetratricopeptide repeat domain 1
Rat(287208) tetratricopeptide repeat domain 1
Zebrafish(492510) tetratricopeptide repeat domain 1
domestic cat(101082466) tetratricopeptide repeat domain 1
dog(489152) tetratricopeptide repeat domain 1
chicken(416152) tetratricopeptide repeat domain 1
cow(504602) tetratricopeptide repeat domain 1
sheep(101115619) tetratricopeptide repeat domain 1
domestic guinea pig(100736037) tetratricopeptide repeat domain 1
naked mole-rat(101700103) tetratricopeptide repeat domain 1
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003314 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003314 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003314 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133795 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133795 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133795 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003314 Rosetta Predictions human pricing
NM_001005529 Rosetta Predictions rat pricing
NM_133795 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003314 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017694 predicted 307
2 SASI_Hs01_00017695 predicted 914
3 SASI_Hs01_00017696 predicted 430
4 SASI_Hs02_00335435 predicted 438
5 SASI_Hs02_00335436 predicted 541
6 SASI_Hs01_00017699 predicted 426
7 SASI_Hs01_00017702 predicted 383
8 SASI_Hs01_00017703 predicted 738
9 SASI_Hs02_00335437 predicted 558
10 SASI_Hs01_00017697 predicted 726
11 SASI_Hs01_00017698 predicted 779
12 SASI_Hs01_00017700 predicted 658
13 SASI_Hs01_00017701 predicted 859
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005529 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198382 predicted 1048
2 SASI_Rn01_00118304 predicted 1200
3 SASI_Rn01_00118305 predicted 796
4 SASI_Rn01_00118306 predicted 971
5 SASI_Rn01_00118307 predicted 1026
6 SASI_Rn01_00118308 predicted 772
7 SASI_Rn01_00118310 predicted 1134
8 SASI_Rn01_00118311 predicted 1135
9 SASI_Rn01_00118312 predicted 901
10 SASI_Rn01_00118313 predicted 781
11 SASI_Rn01_00118309 predicted 896
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133795 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106877 predicted 1122
2 SASI_Mm01_00106878 predicted 758
3 SASI_Mm01_00106879 predicted 634
4 SASI_Mm02_00338821 predicted 811
5 SASI_Mm01_00106881 predicted 1125
6 SASI_Mm01_00106882 predicted 787
7 SASI_Mm01_00106883 predicted 909
8 SASI_Mm01_00106884 predicted 884
9 SASI_Mm01_00106885 predicted 1051
10 SASI_Mm01_00106886 predicted 702
11 SASI_Mm01_00106880 predicted 669
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003314
VALIDATED
TTC1 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183743    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003314.1-1104s1c1
Sequence:CCGGCCTGATGTAATGAACCTAATTCTCGAGAATTAGGTTCATTACATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003314.1-881s1c1
Sequence:CCGGCGGCTCGTACTCCATCAATTTCTCGAGAAATTGATGGAGTACGAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003314.1-815s1c1
Sequence:CCGGGAACTTGGTTCTCCGACCTTTCTCGAGAAAGGTCGGAGAACCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250122    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_003314.1-1105s21c1
Sequence:CCGGCTGATGTAATGAACCTAATTTCTCGAGAAATTAGGTTCATTACATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003314.1-465s21c1
Sequence:CCGGTATAGTCGAGCCCTCGAAATGCTCGAGCATTTCGAGGGCTCGACTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003314.1-880s21c1
Sequence:CCGGCCGGCTCGTACTCCATCAATTCTCGAGAATTGATGGAGTACGAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003314.1-389s21c1
Sequence:CCGGAGAAGAGAGCACTAGACTAAACTCGAGTTTAGTCTAGTGCTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003314.1-608s21c1
Sequence:CCGGCAGCTATATCAGGGCAATATTCTCGAGAATATTGCCCTGATATAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003314
VALIDATED
TTC1 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183743    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003314.1-1104s1c1
Sequence:CCGGCCTGATGTAATGAACCTAATTCTCGAGAATTAGGTTCATTACATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003314.1-881s1c1
Sequence:CCGGCGGCTCGTACTCCATCAATTTCTCGAGAAATTGATGGAGTACGAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003314.1-815s1c1
Sequence:CCGGGAACTTGGTTCTCCGACCTTTCTCGAGAAAGGTCGGAGAACCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250122    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_003314.1-1105s21c1
Sequence:CCGGCTGATGTAATGAACCTAATTTCTCGAGAAATTAGGTTCATTACATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003314.1-465s21c1
Sequence:CCGGTATAGTCGAGCCCTCGAAATGCTCGAGCATTTCGAGGGCTCGACTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003314.1-880s21c1
Sequence:CCGGCCGGCTCGTACTCCATCAATTCTCGAGAATTGATGGAGTACGAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003314.1-389s21c1
Sequence:CCGGAGAAGAGAGCACTAGACTAAACTCGAGTTTAGTCTAGTGCTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003314.1-608s21c1
Sequence:CCGGCAGCTATATCAGGGCAATATTCTCGAGAATATTGCCCTGATATAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003314
VALIDATED
TTC1 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183743    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003314.1-1104s1c1
Sequence:CCGGCCTGATGTAATGAACCTAATTCTCGAGAATTAGGTTCATTACATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003314.1-881s1c1
Sequence:CCGGCGGCTCGTACTCCATCAATTTCTCGAGAAATTGATGGAGTACGAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003314.1-815s1c1
Sequence:CCGGGAACTTGGTTCTCCGACCTTTCTCGAGAAAGGTCGGAGAACCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250122    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_003314.1-1105s21c1
Sequence:CCGGCTGATGTAATGAACCTAATTTCTCGAGAAATTAGGTTCATTACATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003314.1-465s21c1
Sequence:CCGGTATAGTCGAGCCCTCGAAATGCTCGAGCATTTCGAGGGCTCGACTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003314.1-880s21c1
Sequence:CCGGCCGGCTCGTACTCCATCAATTCTCGAGAATTGATGGAGTACGAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003314.1-389s21c1
Sequence:CCGGAGAAGAGAGCACTAGACTAAACTCGAGTTTAGTCTAGTGCTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003314.1-608s21c1
Sequence:CCGGCAGCTATATCAGGGCAATATTCTCGAGAATATTGCCCTGATATAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133795
TTC1 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115161    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133795.1-1129s1c1
Sequence:CCGGCCTGATGTATGAGCCTCATTACTCGAGTAATGAGGCTCATACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133795.1-524s1c1
Sequence:CCGGCCAGCCTGTTTCCAGAAAGATCTCGAGATCTTTCTGGAAACAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133795.1-460s1c1
Sequence:CCGGGCGGTTTAAGAGAGGAGATTACTCGAGTAATCTCCTCTCTTAAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133795.1-641s1c1
Sequence:CCGGCCCACCTATATCCGTGCAATACTCGAGTATTGCACGGATATAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133795.1-771s1c1
Sequence:CCGGGTATGAGATTACCTAAGCAAACTCGAGTTTGCTTAGGTAATCTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133795.1-460s21c1
Sequence:CCGGGCGGTTTAAGAGAGGAGATTACTCGAGTAATCTCCTCTCTTAAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133795.1-771s21c1
Sequence:CCGGGTATGAGATTACCTAAGCAAACTCGAGTTTGCTTAGGTAATCTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133795.1-524s21c1
Sequence:CCGGCCAGCCTGTTTCCAGAAAGATCTCGAGATCTTTCTGGAAACAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133795.1-1129s21c1
Sequence:CCGGCCTGATGTATGAGCCTCATTACTCGAGTAATGAGGCTCATACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133795.1-641s21c1
Sequence:CCGGCCCACCTATATCCGTGCAATACTCGAGTATTGCACGGATATAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133795
TTC1 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115161    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133795.1-1129s1c1
Sequence:CCGGCCTGATGTATGAGCCTCATTACTCGAGTAATGAGGCTCATACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133795.1-524s1c1
Sequence:CCGGCCAGCCTGTTTCCAGAAAGATCTCGAGATCTTTCTGGAAACAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133795.1-460s1c1
Sequence:CCGGGCGGTTTAAGAGAGGAGATTACTCGAGTAATCTCCTCTCTTAAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133795.1-641s1c1
Sequence:CCGGCCCACCTATATCCGTGCAATACTCGAGTATTGCACGGATATAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133795.1-771s1c1
Sequence:CCGGGTATGAGATTACCTAAGCAAACTCGAGTTTGCTTAGGTAATCTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133795.1-460s21c1
Sequence:CCGGGCGGTTTAAGAGAGGAGATTACTCGAGTAATCTCCTCTCTTAAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133795.1-771s21c1
Sequence:CCGGGTATGAGATTACCTAAGCAAACTCGAGTTTGCTTAGGTAATCTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133795.1-524s21c1
Sequence:CCGGCCAGCCTGTTTCCAGAAAGATCTCGAGATCTTTCTGGAAACAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133795.1-1129s21c1
Sequence:CCGGCCTGATGTATGAGCCTCATTACTCGAGTAATGAGGCTCATACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133795.1-641s21c1
Sequence:CCGGCCCACCTATATCCGTGCAATACTCGAGTATTGCACGGATATAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133795
TTC1 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115161    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133795.1-1129s1c1
Sequence:CCGGCCTGATGTATGAGCCTCATTACTCGAGTAATGAGGCTCATACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133795.1-524s1c1
Sequence:CCGGCCAGCCTGTTTCCAGAAAGATCTCGAGATCTTTCTGGAAACAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133795.1-460s1c1
Sequence:CCGGGCGGTTTAAGAGAGGAGATTACTCGAGTAATCTCCTCTCTTAAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133795.1-641s1c1
Sequence:CCGGCCCACCTATATCCGTGCAATACTCGAGTATTGCACGGATATAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133795.1-771s1c1
Sequence:CCGGGTATGAGATTACCTAAGCAAACTCGAGTTTGCTTAGGTAATCTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133795.1-460s21c1
Sequence:CCGGGCGGTTTAAGAGAGGAGATTACTCGAGTAATCTCCTCTCTTAAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133795.1-771s21c1
Sequence:CCGGGTATGAGATTACCTAAGCAAACTCGAGTTTGCTTAGGTAATCTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133795.1-524s21c1
Sequence:CCGGCCAGCCTGTTTCCAGAAAGATCTCGAGATCTTTCTGGAAACAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133795.1-1129s21c1
Sequence:CCGGCCTGATGTATGAGCCTCATTACTCGAGTAATGAGGCTCATACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133795.1-641s21c1
Sequence:CCGGCCCACCTATATCCGTGCAATACTCGAGTATTGCACGGATATAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks