EMAIL THIS PAGE TO A FRIEND

TTC21A

tetratricopeptide repeat domain 21A

Synonyms: STI2
Gene ID:
Mouse(74052) tetratricopeptide repeat domain 21A
Rat(301065) tetratricopeptide repeat domain 21A
cow(540604) tetratricopeptide repeat domain 21A
sheep(101112092) tetratricopeptide repeat domain 21A
domestic guinea pig(100724535) tetratricopeptide repeat domain 21A
naked mole-rat(101709051) tetratricopeptide repeat domain 21A
Horse(100068431) tetratricopeptide repeat domain 21A
domestic cat(101084822) tetratricopeptide repeat domain 21A
dog(485595) tetratricopeptide repeat domain 21A
128 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA035510 Anti-TTC21A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028735 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028735 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028735 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145755 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145755 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145755 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105513 Rosetta Predictions human pricing
NM_145755 Rosetta Predictions human pricing
XM_001078305 Rosetta Predictions rat pricing
XM_236701 Rosetta Predictions rat pricing
NM_028735 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105513 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324124 predicted 450
2 SASI_Hs02_00324125 predicted 2838
3 SASI_Hs02_00324126 predicted 2655
4 SASI_Hs02_00324127 predicted 3175
5 SASI_Hs02_00324128 predicted 3235
6 SASI_Hs02_00324129 predicted 1279
7 SASI_Hs02_00324130 predicted 3820
8 SASI_Hs02_00324131 predicted 657
9 SASI_Hs02_00324132 predicted 727
10 SASI_Hs02_00324133 predicted 3881
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145755 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227119 predicted 449
2 SASI_Hs01_00227120 predicted 2833
3 SASI_Hs01_00227121 predicted 2654
4 SASI_Hs01_00227122 predicted 3171
5 SASI_Hs01_00227124 predicted 3231
6 SASI_Hs02_00365342 predicted 1282
7 SASI_Hs01_00227125 predicted 3815
8 SASI_Hs01_00227126 predicted 664
9 SASI_Hs01_00227127 predicted 736
10 SASI_Hs01_00227128 predicted 3886
11 SASI_Hs01_00227123 predicted 2671
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078305 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360280 predicted 370
2 SASI_Rn02_00360281 predicted 678
3 SASI_Rn02_00360282 predicted 1560
4 SASI_Rn02_00360283 predicted 3031
5 SASI_Rn02_00360284 predicted 646
6 SASI_Rn02_00360285 predicted 2430
7 SASI_Rn02_00360286 predicted 3234
8 SASI_Rn02_00360287 predicted 2648
9 SASI_Rn02_00360288 predicted 944
10 SASI_Rn02_00360289 predicted 746
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236701 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122814 predicted 275
2 SASI_Rn01_00122815 predicted 582
3 SASI_Rn01_00122816 predicted 3374
4 SASI_Rn01_00122817 predicted 549
5 SASI_Rn01_00122818 predicted 3462
6 SASI_Rn01_00122819 predicted 3289
7 SASI_Rn01_00122820 predicted 839
8 SASI_Rn01_00122821 predicted 654
9 SASI_Rn01_00122822 predicted 3209
10 SASI_Rn01_00122823 predicted 3389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028735 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167098 predicted 3844
2 SASI_Mm01_00167099 predicted 741
3 SASI_Mm01_00167100 predicted 3332
4 SASI_Mm01_00167101 predicted 673
5 SASI_Mm01_00167102 predicted 3418
6 SASI_Mm01_00167103 predicted 3226
7 SASI_Mm01_00167104 predicted 2344
8 SASI_Mm01_00167106 predicted 1974
9 SASI_Mm02_00334310 predicted 3158
10 SASI_Mm01_00167107 predicted 1523
11 SASI_Mm01_00167105 predicted 1971
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028735
TTC21A MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 21A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028735.1-1868s1c1
Sequence:CCGGCGAGGCCATAAAGACCTTAAACTCGAGTTTAAGGTCTTTATGGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028735.1-2599s1c1
Sequence:CCGGCCATGATAAATGAGGTCAAGTCTCGAGACTTGACCTCATTTATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028735.1-820s1c1
Sequence:CCGGCGATAGAAACCGGACAAAGAACTCGAGTTCTTTGTCCGGTTTCTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028735.1-990s1c1
Sequence:CCGGCATCTTAAGAAGATCCTTGTACTCGAGTACAAGGATCTTCTTAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028735.1-3081s1c1
Sequence:CCGGGTATTGAATAAACTGGTCGATCTCGAGATCGACCAGTTTATTCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028735
TTC21A MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 21A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028735.1-1868s1c1
Sequence:CCGGCGAGGCCATAAAGACCTTAAACTCGAGTTTAAGGTCTTTATGGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028735.1-2599s1c1
Sequence:CCGGCCATGATAAATGAGGTCAAGTCTCGAGACTTGACCTCATTTATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028735.1-820s1c1
Sequence:CCGGCGATAGAAACCGGACAAAGAACTCGAGTTCTTTGTCCGGTTTCTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028735.1-990s1c1
Sequence:CCGGCATCTTAAGAAGATCCTTGTACTCGAGTACAAGGATCTTCTTAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028735.1-3081s1c1
Sequence:CCGGGTATTGAATAAACTGGTCGATCTCGAGATCGACCAGTTTATTCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028735
TTC21A MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 21A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028735.1-1868s1c1
Sequence:CCGGCGAGGCCATAAAGACCTTAAACTCGAGTTTAAGGTCTTTATGGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028735.1-2599s1c1
Sequence:CCGGCCATGATAAATGAGGTCAAGTCTCGAGACTTGACCTCATTTATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028735.1-820s1c1
Sequence:CCGGCGATAGAAACCGGACAAAGAACTCGAGTTCTTTGTCCGGTTTCTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028735.1-990s1c1
Sequence:CCGGCATCTTAAGAAGATCCTTGTACTCGAGTACAAGGATCTTCTTAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028735.1-3081s1c1
Sequence:CCGGGTATTGAATAAACTGGTCGATCTCGAGATCGACCAGTTTATTCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145755
TTC21A MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 21A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145755.1-1601s1c1
Sequence:CCGGGCCGTGATCTTGAATCCTGTACTCGAGTACAGGATTCAAGATCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145755.1-876s1c1
Sequence:CCGGGCAATATTGATGCCTGCCAAACTCGAGTTTGGCAGGCATCAATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145755.2-2239s21c1
Sequence:CCGGCCCAAGCAGTCCTGCTATATGCTCGAGCATATAGCAGGACTGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145755.2-2512s21c1
Sequence:CCGGACTGAGGCAATTGAGTATTATCTCGAGATAATACTCAATTGCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145755.2-3096s21c1
Sequence:CCGGTGAAGCGGCCATCAATCTTTACTCGAGTAAAGATTGATGGCCGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145755.2-1382s21c1
Sequence:CCGGGGAAGTCTGAGGTGCTAATTTCTCGAGAAATTAGCACCTCAGACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145755
TTC21A MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 21A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145755.1-1601s1c1
Sequence:CCGGGCCGTGATCTTGAATCCTGTACTCGAGTACAGGATTCAAGATCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145755.1-876s1c1
Sequence:CCGGGCAATATTGATGCCTGCCAAACTCGAGTTTGGCAGGCATCAATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145755.2-2239s21c1
Sequence:CCGGCCCAAGCAGTCCTGCTATATGCTCGAGCATATAGCAGGACTGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145755.2-2512s21c1
Sequence:CCGGACTGAGGCAATTGAGTATTATCTCGAGATAATACTCAATTGCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145755.2-3096s21c1
Sequence:CCGGTGAAGCGGCCATCAATCTTTACTCGAGTAAAGATTGATGGCCGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145755.2-1382s21c1
Sequence:CCGGGGAAGTCTGAGGTGCTAATTTCTCGAGAAATTAGCACCTCAGACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145755
TTC21A MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 21A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145755.1-1601s1c1
Sequence:CCGGGCCGTGATCTTGAATCCTGTACTCGAGTACAGGATTCAAGATCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145755.1-876s1c1
Sequence:CCGGGCAATATTGATGCCTGCCAAACTCGAGTTTGGCAGGCATCAATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145755.2-2239s21c1
Sequence:CCGGCCCAAGCAGTCCTGCTATATGCTCGAGCATATAGCAGGACTGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145755.2-2512s21c1
Sequence:CCGGACTGAGGCAATTGAGTATTATCTCGAGATAATACTCAATTGCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145755.2-3096s21c1
Sequence:CCGGTGAAGCGGCCATCAATCTTTACTCGAGTAAAGATTGATGGCCGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145755.2-1382s21c1
Sequence:CCGGGGAAGTCTGAGGTGCTAATTTCTCGAGAAATTAGCACCTCAGACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks