EMAIL THIS PAGE TO A FRIEND

TTC21B

tetratricopeptide repeat domain 21B

Synonyms: ATD4 IFT139 JBTS11 NPHP12 THM1
Gene ID:
Human(79809) Summary: This gene encodes a member of TTC21 family, containing several tetratricopeptide repeat (TPR) domains. This protein is localized to the cilium axoneme, and may play a role in retrograde intraflagellar transport in cilia. Mutations in this gene are associated with various ciliopathies, nephronophthisis 12, and asphyxiating thoracic dystrophy 4. [provided by RefSeq, Oct 2011]
Mouse(73668) tetratricopeptide repeat domain 21B
Rat(295654) tetratricopeptide repeat domain 21B
Zebrafish(569823) tetratricopeptide repeat domain 21B
Horse(100052001) tetratricopeptide repeat domain 21B
domestic cat(101081565) tetratricopeptide repeat domain 21B
dog(608674) tetratricopeptide repeat domain 21B
chicken(424176) tetratricopeptide repeat domain 21B
naked mole-rat(101707048) tetratricopeptide repeat domain 21B
domestic guinea pig(100715091) tetratricopeptide repeat domain 21B
cow(527412) tetratricopeptide repeat domain 21B
sheep(101102621) tetratricopeptide repeat domain 21B
94 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA035495 Anti-TTC21B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024753 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024753 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024753 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001047604 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001047604 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001047604 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024753 Rosetta Predictions human pricing
XM_001056795 Rosetta Predictions rat pricing
XM_229983 Rosetta Predictions rat pricing
NM_001047604 Rosetta Predictions mouse pricing
XM_130319 Rosetta Predictions mouse pricing
XM_899617 Rosetta Predictions mouse pricing
XM_899621 Rosetta Predictions mouse pricing
XM_899628 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024753 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231242 predicted 1860
2 SASI_Hs01_00231244 predicted 2001
3 SASI_Hs02_00357247 predicted 3688
4 SASI_Hs02_00357248 predicted 2928
5 SASI_Hs01_00231245 predicted 1011
6 SASI_Hs02_00357249 predicted 2370
7 SASI_Hs01_00231246 predicted 3100
8 SASI_Hs01_00231247 predicted 418
9 SASI_Hs01_00231248 predicted 3918
10 SASI_Hs01_00231249 predicted 1961
11 SASI_Hs01_00231241 predicted 1185
12 SASI_Hs01_00231243 predicted 728
13 SASI_Hs01_00231250 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056795 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284479 predicted 1908
2 SASI_Rn02_00284480 predicted 965
3 SASI_Rn02_00284481 predicted 3558
4 SASI_Rn02_00284482 predicted 506
5 SASI_Rn02_00284483 predicted 792
6 SASI_Rn02_00284484 predicted 204
7 SASI_Rn02_00284485 predicted 221
8 SASI_Rn02_00284486 predicted 1853
9 SASI_Rn02_00284487 predicted 2080
10 SASI_Rn02_00284488 predicted 3920
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_229983 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386052 predicted 3158
2 SASI_Rn02_00386053 predicted 806
3 SASI_Rn02_00386054 predicted 886
4 SASI_Rn02_00386055 predicted 3440
5 SASI_Rn02_00386056 predicted 962
6 SASI_Rn02_00386057 predicted 3549
7 SASI_Rn02_00386058 predicted 2787
8 SASI_Rn02_00386059 predicted 498
9 SASI_Rn02_00386060 predicted 790
10 SASI_Rn02_00386061 predicted 198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047604 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291931 predicted 2078
2 SASI_Mm02_00291932 predicted 2626
3 SASI_Mm02_00291933 predicted 2089
4 SASI_Mm02_00291934 predicted 2974
5 SASI_Mm02_00291935 predicted 2775
6 SASI_Mm02_00291936 predicted 2401
7 SASI_Mm02_00291937 predicted 3505
8 SASI_Mm02_00291938 predicted 2196
9 SASI_Mm02_00291939 predicted 2476
10 SASI_Mm02_00291940 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130319 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00260892 predicted 2081
2 SASI_Mm01_00260893 predicted 2638
3 SASI_Mm01_00260894 predicted 2103
4 SASI_Mm01_00260895 predicted 2986
5 SASI_Mm01_00260896 predicted 2780
6 SASI_Mm01_00260897 predicted 3809
7 SASI_Mm01_00260898 predicted 2406
8 SASI_Mm01_00260899 predicted 3502
9 SASI_Mm01_00260900 predicted 990
10 SASI_Mm01_00260901 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899617 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281362 predicted 2086
2 SASI_Mm01_00281363 predicted 2101
3 SASI_Mm01_00281364 predicted 1766
4 SASI_Mm01_00281365 predicted 2579
5 SASI_Mm01_00281366 predicted 2404
6 SASI_Mm01_00281367 predicted 2197
7 SASI_Mm01_00281368 predicted 2480
8 SASI_Mm01_00281369 predicted 986
9 SASI_Mm01_00281370 predicted 750
10 SASI_Mm01_00281371 predicted 1759
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899621 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00237097 predicted 256
2 SASI_Mm01_00237098 predicted 692
3 SASI_Mm01_00237099 predicted 917
4 SASI_Mm01_00237100 predicted 909
5 SASI_Mm01_00237101 predicted 988
6 SASI_Mm01_00237102 predicted 756
7 SASI_Mm01_00237103 predicted 300
8 SASI_Mm01_00237104 predicted 466
9 SASI_Mm01_00237105 predicted 985
10 SASI_Mm01_00237106 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899628 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236483 predicted 2087
2 SASI_Mm01_00236484 predicted 2642
3 SASI_Mm01_00236485 predicted 2103
4 SASI_Mm01_00236486 predicted 2986
5 SASI_Mm01_00236487 predicted 2785
6 SASI_Mm01_00236488 predicted 3811
7 SASI_Mm01_00236489 predicted 2403
8 SASI_Mm01_00236490 predicted 3507
9 SASI_Mm01_00236491 predicted 749
10 SASI_Mm01_00236492 predicted 2529
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024753
TTC21B MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 21B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024753.3-4055s21c1
Sequence:CCGGGATAAGGCCCGTGCGTCTTTACTCGAGTAAAGACGCACGGGCCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024753.3-2896s21c1
Sequence:CCGGGTTGGAACTGGCACGATTATACTCGAGTATAATCGTGCCAGTTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024753.3-3487s21c1
Sequence:CCGGTCACGTACAGCTTCGCATAATCTCGAGATTATGCGAAGCTGTACGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024753.2-2375s1c1
Sequence:CCGGGCATTAAATCAGAACCCGAAACTCGAGTTTCGGGTTCTGATTTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024753.2-3557s1c1
Sequence:CCGGGCATTAAATACCTTCACTGAACTCGAGTTCAGTGAAGGTATTTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167210    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024753.2-4682s1c1
Sequence:CCGGCCTAGCAATACACATTAAGAACTCGAGTTCTTAATGTGTATTGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024753.2-500s1c1
Sequence:CCGGCGCCATGATAAAGCAAGGGAACTCGAGTTCCCTTGCTTTATCATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024753.2-2150s1c1
Sequence:CCGGGCTTTAAGCATCCTTCAGAATCTCGAGATTCTGAAGGATGCTTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024753
TTC21B MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 21B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024753.3-4055s21c1
Sequence:CCGGGATAAGGCCCGTGCGTCTTTACTCGAGTAAAGACGCACGGGCCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024753.3-2896s21c1
Sequence:CCGGGTTGGAACTGGCACGATTATACTCGAGTATAATCGTGCCAGTTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024753.3-3487s21c1
Sequence:CCGGTCACGTACAGCTTCGCATAATCTCGAGATTATGCGAAGCTGTACGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024753.2-2375s1c1
Sequence:CCGGGCATTAAATCAGAACCCGAAACTCGAGTTTCGGGTTCTGATTTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024753.2-3557s1c1
Sequence:CCGGGCATTAAATACCTTCACTGAACTCGAGTTCAGTGAAGGTATTTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167210    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024753.2-4682s1c1
Sequence:CCGGCCTAGCAATACACATTAAGAACTCGAGTTCTTAATGTGTATTGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024753.2-500s1c1
Sequence:CCGGCGCCATGATAAAGCAAGGGAACTCGAGTTCCCTTGCTTTATCATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024753.2-2150s1c1
Sequence:CCGGGCTTTAAGCATCCTTCAGAATCTCGAGATTCTGAAGGATGCTTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024753
TTC21B MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 21B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024753.3-4055s21c1
Sequence:CCGGGATAAGGCCCGTGCGTCTTTACTCGAGTAAAGACGCACGGGCCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024753.3-2896s21c1
Sequence:CCGGGTTGGAACTGGCACGATTATACTCGAGTATAATCGTGCCAGTTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024753.3-3487s21c1
Sequence:CCGGTCACGTACAGCTTCGCATAATCTCGAGATTATGCGAAGCTGTACGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024753.2-2375s1c1
Sequence:CCGGGCATTAAATCAGAACCCGAAACTCGAGTTTCGGGTTCTGATTTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024753.2-3557s1c1
Sequence:CCGGGCATTAAATACCTTCACTGAACTCGAGTTCAGTGAAGGTATTTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167210    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024753.2-4682s1c1
Sequence:CCGGCCTAGCAATACACATTAAGAACTCGAGTTCTTAATGTGTATTGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024753.2-500s1c1
Sequence:CCGGCGCCATGATAAAGCAAGGGAACTCGAGTTCCCTTGCTTTATCATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024753.2-2150s1c1
Sequence:CCGGGCTTTAAGCATCCTTCAGAATCTCGAGATTCTGAAGGATGCTTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001047604
TTC21B MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 21B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047604.1-120s21c1
Sequence:CCGGTATTGTCAAGAGCGCTATTATCTCGAGATAATAGCGCTCTTGACAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047604.1-255s21c1
Sequence:CCGGCGGGAGTTTGAGGCCATTAAACTCGAGTTTAATGGCCTCAAACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001047604.1-4296s21c1
Sequence:CCGGGTTAAAGTCTGGGTGATATATCTCGAGATATATCACCCAGACTTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047604.1-1758s21c1
Sequence:CCGGGTGAGAGAGTACCCATTATATCTCGAGATATAATGGGTACTCTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047604.1-3563s21c1
Sequence:CCGGGGGAATGGCAACGGCTTATATCTCGAGATATAAGCCGTTGCCATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001047604
TTC21B MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 21B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047604.1-120s21c1
Sequence:CCGGTATTGTCAAGAGCGCTATTATCTCGAGATAATAGCGCTCTTGACAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047604.1-255s21c1
Sequence:CCGGCGGGAGTTTGAGGCCATTAAACTCGAGTTTAATGGCCTCAAACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001047604.1-4296s21c1
Sequence:CCGGGTTAAAGTCTGGGTGATATATCTCGAGATATATCACCCAGACTTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047604.1-1758s21c1
Sequence:CCGGGTGAGAGAGTACCCATTATATCTCGAGATATAATGGGTACTCTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047604.1-3563s21c1
Sequence:CCGGGGGAATGGCAACGGCTTATATCTCGAGATATAAGCCGTTGCCATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001047604
TTC21B MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 21B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047604.1-120s21c1
Sequence:CCGGTATTGTCAAGAGCGCTATTATCTCGAGATAATAGCGCTCTTGACAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047604.1-255s21c1
Sequence:CCGGCGGGAGTTTGAGGCCATTAAACTCGAGTTTAATGGCCTCAAACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001047604.1-4296s21c1
Sequence:CCGGGTTAAAGTCTGGGTGATATATCTCGAGATATATCACCCAGACTTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047604.1-1758s21c1
Sequence:CCGGGTGAGAGAGTACCCATTATATCTCGAGATATAATGGGTACTCTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047604.1-3563s21c1
Sequence:CCGGGGGAATGGCAACGGCTTATATCTCGAGATATAAGCCGTTGCCATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks