EMAIL THIS PAGE TO A FRIEND

TTC22

tetratricopeptide repeat domain 22

UniProtKB ID: Q5TAA0, Q9NWT4
Gene ID:
Human(55001) Summary: This gene encodes a protein with seven tetratricopeptide (TPR) repeats. Tetratricopeptide repeat containing motifs are found in a variety of proteins and may mediate protein-protein interactions and chaperone activity. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2011]
Mouse(230576) tetratricopeptide repeat domain 22
Rat(298300) tetratricopeptide repeat domain 22
cow(522691) tetratricopeptide repeat domain 22
sheep(101122900) tetratricopeptide repeat domain 22
domestic guinea pig(100732639) tetratricopeptide repeat domain 22
naked mole-rat(101704343) tetratricopeptide repeat domain 22
Domestic Rabbit(100339658) tetratricopeptide repeat domain 22
Zebrafish(497576) tetratricopeptide repeat domain 22
domestic cat(101094525) tetratricopeptide repeat domain 22
dog(610541) tetratricopeptide repeat domain 22
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177667 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177667 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177667 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017904 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017904 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017904 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114108 Rosetta Predictions human pricing
NM_017904 Rosetta Predictions human pricing
NM_001106671 Rosetta Predictions rat pricing
NM_177667 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114108 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326274 predicted 800
2 SASI_Hs02_00326275 predicted 410
3 SASI_Hs02_00326276 predicted 634
4 SASI_Hs02_00326277 predicted 693
5 SASI_Hs02_00326278 predicted 687
6 SASI_Hs02_00326279 predicted 395
7 SASI_Hs02_00326280 predicted 706
8 SASI_Hs02_00326281 predicted 807
9 SASI_Hs02_00326282 predicted 328
10 SASI_Hs02_00326283 predicted 723
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017904 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142521 predicted 794
2 SASI_Hs01_00142522 predicted 412
3 SASI_Hs01_00142523 predicted 634
4 SASI_Hs01_00142524 predicted 692
5 SASI_Hs01_00142525 predicted 691
6 SASI_Hs01_00142526 predicted 398
7 SASI_Hs01_00142527 predicted 709
8 SASI_Hs01_00142528 predicted 802
9 SASI_Hs01_00142529 predicted 326
10 SASI_Hs01_00142530 predicted 723
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106671 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221238 predicted 1372
2 SASI_Rn02_00221239 predicted 856
3 SASI_Rn02_00221240 predicted 1031
4 SASI_Rn02_00221241 predicted 1461
5 SASI_Rn02_00221242 predicted 1264
6 SASI_Rn02_00221243 predicted 1815
7 SASI_Rn02_00221244 predicted 1424
8 SASI_Rn02_00221245 predicted 1261
9 SASI_Rn02_00221246 predicted 1079
10 SASI_Rn02_00221247 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177667 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172839 predicted 1948
2 SASI_Mm01_00172840 predicted 1363
3 SASI_Mm02_00347969 predicted 956
4 SASI_Mm01_00172841 predicted 1131
5 SASI_Mm01_00172842 predicted 2044
6 SASI_Mm01_00172843 predicted 1254
7 SASI_Mm01_00172844 predicted 1047
8 SASI_Mm01_00172845 predicted 1271
9 SASI_Mm01_00172846 predicted 1066
10 SASI_Mm01_00172847 predicted 969
11 SASI_Mm01_00172848 predicted 1264
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177667
TTC22 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 22
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177667.2-143s1c1
Sequence:CCGGCTTCTCGATGAACTGGACTATCTCGAGATAGTCCAGTTCATCGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191950    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177667.2-2258s1c1
Sequence:CCGGGTCTCAGAAGTAACTTTCTATCTCGAGATAGAAAGTTACTTCTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177667.2-909s1c1
Sequence:CCGGGTGTCCATGAATACGGGTACTCTCGAGAGTACCCGTATTCATGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177667.3-1248s21c1
Sequence:CCGGCCTCAGGACCTACCTAGATATCTCGAGATATCTAGGTAGGTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177667.3-2051s21c1
Sequence:CCGGGGATATTGTGAATGGGTATTTCTCGAGAAATACCCATTCACAATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177667.3-701s21c1
Sequence:CCGGTCACCATGGCAACACTCTTTACTCGAGTAAAGAGTGTTGCCATGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177667.3-659s21c1
Sequence:CCGGATGGTCAGCAGATCCCGATAGCTCGAGCTATCGGGATCTGCTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177667.3-900s21c1
Sequence:CCGGCCCTATGGGTGTCCATGAATACTCGAGTATTCATGGACACCCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177667
TTC22 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 22
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177667.2-143s1c1
Sequence:CCGGCTTCTCGATGAACTGGACTATCTCGAGATAGTCCAGTTCATCGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191950    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177667.2-2258s1c1
Sequence:CCGGGTCTCAGAAGTAACTTTCTATCTCGAGATAGAAAGTTACTTCTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177667.2-909s1c1
Sequence:CCGGGTGTCCATGAATACGGGTACTCTCGAGAGTACCCGTATTCATGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177667.3-1248s21c1
Sequence:CCGGCCTCAGGACCTACCTAGATATCTCGAGATATCTAGGTAGGTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177667.3-2051s21c1
Sequence:CCGGGGATATTGTGAATGGGTATTTCTCGAGAAATACCCATTCACAATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177667.3-701s21c1
Sequence:CCGGTCACCATGGCAACACTCTTTACTCGAGTAAAGAGTGTTGCCATGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177667.3-659s21c1
Sequence:CCGGATGGTCAGCAGATCCCGATAGCTCGAGCTATCGGGATCTGCTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177667.3-900s21c1
Sequence:CCGGCCCTATGGGTGTCCATGAATACTCGAGTATTCATGGACACCCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177667
TTC22 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 22
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177667.2-143s1c1
Sequence:CCGGCTTCTCGATGAACTGGACTATCTCGAGATAGTCCAGTTCATCGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191950    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177667.2-2258s1c1
Sequence:CCGGGTCTCAGAAGTAACTTTCTATCTCGAGATAGAAAGTTACTTCTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177667.2-909s1c1
Sequence:CCGGGTGTCCATGAATACGGGTACTCTCGAGAGTACCCGTATTCATGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177667.3-1248s21c1
Sequence:CCGGCCTCAGGACCTACCTAGATATCTCGAGATATCTAGGTAGGTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177667.3-2051s21c1
Sequence:CCGGGGATATTGTGAATGGGTATTTCTCGAGAAATACCCATTCACAATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177667.3-701s21c1
Sequence:CCGGTCACCATGGCAACACTCTTTACTCGAGTAAAGAGTGTTGCCATGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177667.3-659s21c1
Sequence:CCGGATGGTCAGCAGATCCCGATAGCTCGAGCTATCGGGATCTGCTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177667.3-900s21c1
Sequence:CCGGCCCTATGGGTGTCCATGAATACTCGAGTATTCATGGACACCCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017904
TTC22 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 22
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143839    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017904.1-1940s1c1
Sequence:CCGGCCTCATCTTCTCCACTACTATCTCGAGATAGTAGTGGAGAAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017904.1-1961s1c1
Sequence:CCGGCCACATGACCTAGTGGCAAATCTCGAGATTTGCCACTAGGTCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017904.1-637s1c1
Sequence:CCGGCCATGGCAACACTCTACATCACTCGAGTGATGTAGAGTGTTGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017904.1-890s1c1
Sequence:CCGGCAAGGCCATTGAGATTGCCAACTCGAGTTGGCAATCTCAATGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017904.1-1939s1c1
Sequence:CCGGCCCTCATCTTCTCCACTACTACTCGAGTAGTAGTGGAGAAGATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017904.1-900s1c1
Sequence:CCGGGAGATTGCCAAGAACCAACCTCTCGAGAGGTTGGTTCTTGGCAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017904.1-642s1c1
Sequence:CCGGGCAACACTCTACATCAGGCTACTCGAGTAGCCTGATGTAGAGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140446    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017904.1-1758s1c1
Sequence:CCGGGCAGTCCACTGCATAGTCATTCTCGAGAATGACTATGCAGTGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017904.1-625s1c1
Sequence:CCGGGCTGGTATTTCACCATGGCAACTCGAGTTGCCATGGTGAAATACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140757    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017904.1-1529s1c1
Sequence:CCGGGCCTTGGTTCAAATCCCACAACTCGAGTTGTGGGATTTGAACCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017904.1-896s1c1
Sequence:CCGGCATTGAGATTGCCAAGAACCACTCGAGTGGTTCTTGGCAATCTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017904
TTC22 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 22
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143839    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017904.1-1940s1c1
Sequence:CCGGCCTCATCTTCTCCACTACTATCTCGAGATAGTAGTGGAGAAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017904.1-1961s1c1
Sequence:CCGGCCACATGACCTAGTGGCAAATCTCGAGATTTGCCACTAGGTCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017904.1-637s1c1
Sequence:CCGGCCATGGCAACACTCTACATCACTCGAGTGATGTAGAGTGTTGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017904.1-890s1c1
Sequence:CCGGCAAGGCCATTGAGATTGCCAACTCGAGTTGGCAATCTCAATGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017904.1-1939s1c1
Sequence:CCGGCCCTCATCTTCTCCACTACTACTCGAGTAGTAGTGGAGAAGATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017904.1-900s1c1
Sequence:CCGGGAGATTGCCAAGAACCAACCTCTCGAGAGGTTGGTTCTTGGCAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017904.1-642s1c1
Sequence:CCGGGCAACACTCTACATCAGGCTACTCGAGTAGCCTGATGTAGAGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140446    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017904.1-1758s1c1
Sequence:CCGGGCAGTCCACTGCATAGTCATTCTCGAGAATGACTATGCAGTGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017904.1-625s1c1
Sequence:CCGGGCTGGTATTTCACCATGGCAACTCGAGTTGCCATGGTGAAATACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140757    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017904.1-1529s1c1
Sequence:CCGGGCCTTGGTTCAAATCCCACAACTCGAGTTGTGGGATTTGAACCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017904.1-896s1c1
Sequence:CCGGCATTGAGATTGCCAAGAACCACTCGAGTGGTTCTTGGCAATCTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017904
TTC22 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 22
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143839    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017904.1-1940s1c1
Sequence:CCGGCCTCATCTTCTCCACTACTATCTCGAGATAGTAGTGGAGAAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017904.1-1961s1c1
Sequence:CCGGCCACATGACCTAGTGGCAAATCTCGAGATTTGCCACTAGGTCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017904.1-637s1c1
Sequence:CCGGCCATGGCAACACTCTACATCACTCGAGTGATGTAGAGTGTTGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017904.1-890s1c1
Sequence:CCGGCAAGGCCATTGAGATTGCCAACTCGAGTTGGCAATCTCAATGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017904.1-1939s1c1
Sequence:CCGGCCCTCATCTTCTCCACTACTACTCGAGTAGTAGTGGAGAAGATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017904.1-900s1c1
Sequence:CCGGGAGATTGCCAAGAACCAACCTCTCGAGAGGTTGGTTCTTGGCAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017904.1-642s1c1
Sequence:CCGGGCAACACTCTACATCAGGCTACTCGAGTAGCCTGATGTAGAGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140446    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017904.1-1758s1c1
Sequence:CCGGGCAGTCCACTGCATAGTCATTCTCGAGAATGACTATGCAGTGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017904.1-625s1c1
Sequence:CCGGGCTGGTATTTCACCATGGCAACTCGAGTTGCCATGGTGAAATACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140757    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017904.1-1529s1c1
Sequence:CCGGGCCTTGGTTCAAATCCCACAACTCGAGTTGTGGGATTTGAACCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017904.1-896s1c1
Sequence:CCGGCATTGAGATTGCCAAGAACCACTCGAGTGGTTCTTGGCAATCTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks