EMAIL THIS PAGE TO A FRIEND

TTC23

tetratricopeptide repeat domain 23

Synonyms: HCC-8
UniProtKB ID: Q5W5X9, A8K6M5, Q53HK0, Q96BC9, Q9H8W9, Q9H9S7
Gene ID:
Mouse(67009) tetratricopeptide repeat domain 23
Rat(308708) tetratricopeptide repeat domain 23
Zebrafish(558875) tetratricopeptide repeat domain 23
domestic cat(101080291) tetratricopeptide repeat domain 23
Horse(100055995) tetratricopeptide repeat domain 23
dog(488710) tetratricopeptide repeat domain 23
naked mole-rat(101708793) tetratricopeptide repeat domain 23
domestic guinea pig(100735678) tetratricopeptide repeat domain 23
cow(529791) tetratricopeptide repeat domain 23
sheep(101110879) tetratricopeptide repeat domain 23
168 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022905 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022905 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022905 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025905 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025905 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025905 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040655 Rosetta Predictions human pricing
NM_001040656 Rosetta Predictions human pricing
NM_001040657 Rosetta Predictions human pricing
NM_001040658 Rosetta Predictions human pricing
NM_001040659 Rosetta Predictions human pricing
NM_001040660 Rosetta Predictions human pricing
NM_022905 Rosetta Predictions human pricing
NM_001025681 Rosetta Predictions rat pricing
NM_025905 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040655 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309030 predicted 1114
2 SASI_Hs01_00076139 predicted 2195
3 SASI_Hs02_00309031 predicted 1633
4 SASI_Hs01_00076140 predicted 1466
5 SASI_Hs01_00076141 predicted 1033
6 SASI_Hs01_00076143 predicted 1141
7 SASI_Hs01_00076144 predicted 1406
8 SASI_Hs02_00309032 predicted 1534
9 SASI_Hs01_00076145 predicted 1812
10 SASI_Hs01_00076146 predicted 1321
11 SASI_Hs01_00076142 predicted 1296
12 SASI_Hs01_00076147 predicted 2144
13 SASI_Hs01_00076148 predicted 1646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040656 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309033 predicted 800
2 SASI_Hs01_00206084 predicted 1883
3 SASI_Hs02_00309034 predicted 1318
4 SASI_Hs01_00206085 predicted 1148
5 SASI_Hs01_00206086 predicted 717
6 SASI_Hs01_00206088 predicted 825
7 SASI_Hs01_00206089 predicted 1093
8 SASI_Hs02_00309035 predicted 1213
9 SASI_Hs01_00206090 predicted 1488
10 SASI_Hs01_00206091 predicted 1001
11 SASI_Hs01_00206087 predicted 978
12 SASI_Hs01_00206092 predicted 1825
13 SASI_Hs01_00206093 predicted 1320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309036 predicted 752
2 SASI_Hs01_00247311 predicted 1829
3 SASI_Hs02_00309037 predicted 1267
4 SASI_Hs01_00247312 predicted 1093
5 SASI_Hs01_00247313 predicted 668
6 SASI_Hs01_00247315 predicted 781
7 SASI_Hs01_00247316 predicted 1038
8 SASI_Hs02_00309038 predicted 1164
9 SASI_Hs01_00247317 predicted 1437
10 SASI_Hs01_00247318 predicted 948
11 SASI_Hs01_00247314 predicted 920
12 SASI_Hs01_00247319 predicted 1774
13 SASI_Hs01_00247320 predicted 1276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309039 predicted 676
2 SASI_Hs01_00010611 predicted 1760
3 SASI_Hs02_00309040 predicted 1194
4 SASI_Hs01_00010612 predicted 1021
5 SASI_Hs01_00010613 predicted 594
6 SASI_Hs01_00010615 predicted 701
7 SASI_Hs01_00010616 predicted 963
8 SASI_Hs02_00309041 predicted 1091
9 SASI_Hs01_00010617 predicted 1371
10 SASI_Hs01_00010618 predicted 880
11 SASI_Hs01_00010614 predicted 851
12 SASI_Hs01_00010619 predicted 1703
13 SASI_Hs01_00010620 predicted 1196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040659 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309042 predicted 559
2 SASI_Hs01_00175804 predicted 1633
3 SASI_Hs02_00309043 predicted 1073
4 SASI_Hs01_00175805 predicted 899
5 SASI_Hs01_00175806 predicted 470
6 SASI_Hs01_00175808 predicted 582
7 SASI_Hs01_00175809 predicted 842
8 SASI_Hs02_00309044 predicted 972
9 SASI_Hs01_00175810 predicted 1241
10 SASI_Hs01_00175811 predicted 754
11 SASI_Hs01_00175807 predicted 729
12 SASI_Hs01_00175812 predicted 1578
13 SASI_Hs01_00175813 predicted 1081
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309045 predicted 998
2 SASI_Hs01_00102255 predicted 2074
3 SASI_Hs02_00309046 predicted 1514
4 SASI_Hs01_00102256 predicted 1347
5 SASI_Hs01_00102257 predicted 911
6 SASI_Hs01_00102259 predicted 1026
7 SASI_Hs01_00102260 predicted 1289
8 SASI_Hs02_00309047 predicted 1412
9 SASI_Hs01_00102261 predicted 1682
10 SASI_Hs01_00102262 predicted 1198
11 SASI_Hs01_00102258 predicted 1173
12 SASI_Hs01_00102263 predicted 2018
13 SASI_Hs01_00102264 predicted 1516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022905 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356210 predicted 874
2 SASI_Hs01_00024667 predicted 1956
3 SASI_Hs02_00356211 predicted 1391
4 SASI_Hs01_00024668 predicted 1222
5 SASI_Hs01_00024669 predicted 789
6 SASI_Hs01_00024671 predicted 896
7 SASI_Hs01_00024672 predicted 1158
8 SASI_Hs02_00356212 predicted 1289
9 SASI_Hs01_00024673 predicted 1562
10 SASI_Hs01_00024674 predicted 1073
11 SASI_Hs01_00024670 predicted 1049
12 SASI_Hs01_00024675 predicted 1902
13 SASI_Hs01_00024676 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025681 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106863 predicted 1006
2 SASI_Rn01_00106864 predicted 1292
3 SASI_Rn01_00106865 predicted 1276
4 SASI_Rn01_00106866 predicted 1581
5 SASI_Rn01_00106867 predicted 650
6 SASI_Rn01_00106868 predicted 1068
7 SASI_Rn01_00106869 predicted 437
8 SASI_Rn01_00106870 predicted 1032
9 SASI_Rn01_00106871 predicted 413
10 SASI_Rn01_00106872 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025905 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194198 predicted 1687
2 SASI_Mm01_00194199 predicted 1478
3 SASI_Mm01_00194200 predicted 723
4 SASI_Mm01_00194201 predicted 1424
5 SASI_Mm01_00194202 predicted 1437
6 SASI_Mm01_00194203 predicted 1100
7 SASI_Mm01_00194204 predicted 996
8 SASI_Mm02_00329260 predicted 504
9 SASI_Mm01_00194205 predicted 695
10 SASI_Mm01_00194206 predicted 1477
11 SASI_Mm01_00194207 predicted 1949
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022905
VALIDATED
TTC23 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 23
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022905.4-1681s21c1
Sequence:CCGGCAGATCCAGACCCTCTTATATCTCGAGATATAAGAGGGTCTGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022905.4-1087s21c1
Sequence:CCGGGCACGGATCAGATTATCATTTCTCGAGAAATGATAATCTGATCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022905.4-1179s21c1
Sequence:CCGGTGAGATCAGTAAAGGTGAAACCTCGAGGTTTCACCTTTACTGATCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022905.4-678s21c1
Sequence:CCGGAGAGAAAGCAAAGTCCTATTCCTCGAGGAATAGGACTTTGCTTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005124    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_022905.2-2250s1c1
Sequence:CCGGCCTTTCTTATAGGAGGCTAATCTCGAGATTAGCCTCCTATAAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022905.2-946s1c1
Sequence:CCGGGCTGCTACAATGTGGAAGAATCTCGAGATTCTTCCACATTGTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_022905.2-491s1c1
Sequence:CCGGGCTGCTGTTAGCATCACTCATCTCGAGATGAGTGATGCTAACAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_022905.2-651s1c1
Sequence:CCGGGCGTAGCACTGACAAGAATTTCTCGAGAAATTCTTGTCAGTGCTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_022905.2-1121s1c1
Sequence:CCGGGTACCCATATTGAGAGAATTACTCGAGTAATTCTCTCAATATGGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022905
VALIDATED
TTC23 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 23
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022905.4-1681s21c1
Sequence:CCGGCAGATCCAGACCCTCTTATATCTCGAGATATAAGAGGGTCTGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022905.4-1087s21c1
Sequence:CCGGGCACGGATCAGATTATCATTTCTCGAGAAATGATAATCTGATCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022905.4-1179s21c1
Sequence:CCGGTGAGATCAGTAAAGGTGAAACCTCGAGGTTTCACCTTTACTGATCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022905.4-678s21c1
Sequence:CCGGAGAGAAAGCAAAGTCCTATTCCTCGAGGAATAGGACTTTGCTTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005124    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_022905.2-2250s1c1
Sequence:CCGGCCTTTCTTATAGGAGGCTAATCTCGAGATTAGCCTCCTATAAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022905.2-946s1c1
Sequence:CCGGGCTGCTACAATGTGGAAGAATCTCGAGATTCTTCCACATTGTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_022905.2-491s1c1
Sequence:CCGGGCTGCTGTTAGCATCACTCATCTCGAGATGAGTGATGCTAACAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_022905.2-651s1c1
Sequence:CCGGGCGTAGCACTGACAAGAATTTCTCGAGAAATTCTTGTCAGTGCTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_022905.2-1121s1c1
Sequence:CCGGGTACCCATATTGAGAGAATTACTCGAGTAATTCTCTCAATATGGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022905
VALIDATED
TTC23 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 23
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022905.4-1681s21c1
Sequence:CCGGCAGATCCAGACCCTCTTATATCTCGAGATATAAGAGGGTCTGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022905.4-1087s21c1
Sequence:CCGGGCACGGATCAGATTATCATTTCTCGAGAAATGATAATCTGATCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022905.4-1179s21c1
Sequence:CCGGTGAGATCAGTAAAGGTGAAACCTCGAGGTTTCACCTTTACTGATCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022905.4-678s21c1
Sequence:CCGGAGAGAAAGCAAAGTCCTATTCCTCGAGGAATAGGACTTTGCTTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005124    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_022905.2-2250s1c1
Sequence:CCGGCCTTTCTTATAGGAGGCTAATCTCGAGATTAGCCTCCTATAAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022905.2-946s1c1
Sequence:CCGGGCTGCTACAATGTGGAAGAATCTCGAGATTCTTCCACATTGTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_022905.2-491s1c1
Sequence:CCGGGCTGCTGTTAGCATCACTCATCTCGAGATGAGTGATGCTAACAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_022905.2-651s1c1
Sequence:CCGGGCGTAGCACTGACAAGAATTTCTCGAGAAATTCTTGTCAGTGCTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_022905.2-1121s1c1
Sequence:CCGGGTACCCATATTGAGAGAATTACTCGAGTAATTCTCTCAATATGGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025905
VALIDATED
TTC23 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 23
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025905.2-683s21c1
Sequence:CCGGCTAGCGGAGGCGTATGTTAATCTCGAGATTAACATACGCCTCCGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025905.2-1672s21c1
Sequence:CCGGTGGAGCGTACGCGAAGCTAAACTCGAGTTTAGCTTCGCGTACGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025905.2-2084s21c1
Sequence:CCGGTGATATGGTGCTCTTGGTTATCTCGAGATAACCAAGAGCACCATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025905.2-1800s21c1
Sequence:CCGGAGTCAAGGCAATCGGTGAAAGCTCGAGCTTTCACCGATTGCCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025905.2-891s21c1
Sequence:CCGGACGCCTCAGAGAACTTGATAACTCGAGTTATCAAGTTCTCTGAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025905.2-644s1c1
Sequence:CCGGGCACTAACAAGAATTTGCTATCTCGAGATAGCAAATTCTTGTTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191618    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025905.2-2014s1c1
Sequence:CCGGGCTGTTTACTTCAGAATGCAACTCGAGTTGCATTCTGAAGTAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025905.2-994s1c1
Sequence:CCGGGCTGTCGTTTGCACAGTTGTACTCGAGTACAACTGTGCAAACGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025905
VALIDATED
TTC23 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 23
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025905.2-683s21c1
Sequence:CCGGCTAGCGGAGGCGTATGTTAATCTCGAGATTAACATACGCCTCCGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025905.2-1672s21c1
Sequence:CCGGTGGAGCGTACGCGAAGCTAAACTCGAGTTTAGCTTCGCGTACGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025905.2-2084s21c1
Sequence:CCGGTGATATGGTGCTCTTGGTTATCTCGAGATAACCAAGAGCACCATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025905.2-1800s21c1
Sequence:CCGGAGTCAAGGCAATCGGTGAAAGCTCGAGCTTTCACCGATTGCCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025905.2-891s21c1
Sequence:CCGGACGCCTCAGAGAACTTGATAACTCGAGTTATCAAGTTCTCTGAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025905.2-644s1c1
Sequence:CCGGGCACTAACAAGAATTTGCTATCTCGAGATAGCAAATTCTTGTTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191618    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025905.2-2014s1c1
Sequence:CCGGGCTGTTTACTTCAGAATGCAACTCGAGTTGCATTCTGAAGTAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025905.2-994s1c1
Sequence:CCGGGCTGTCGTTTGCACAGTTGTACTCGAGTACAACTGTGCAAACGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025905
VALIDATED
TTC23 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 23
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025905.2-683s21c1
Sequence:CCGGCTAGCGGAGGCGTATGTTAATCTCGAGATTAACATACGCCTCCGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025905.2-1672s21c1
Sequence:CCGGTGGAGCGTACGCGAAGCTAAACTCGAGTTTAGCTTCGCGTACGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025905.2-2084s21c1
Sequence:CCGGTGATATGGTGCTCTTGGTTATCTCGAGATAACCAAGAGCACCATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025905.2-1800s21c1
Sequence:CCGGAGTCAAGGCAATCGGTGAAAGCTCGAGCTTTCACCGATTGCCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025905.2-891s21c1
Sequence:CCGGACGCCTCAGAGAACTTGATAACTCGAGTTATCAAGTTCTCTGAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025905.2-644s1c1
Sequence:CCGGGCACTAACAAGAATTTGCTATCTCGAGATAGCAAATTCTTGTTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191618    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025905.2-2014s1c1
Sequence:CCGGGCTGTTTACTTCAGAATGCAACTCGAGTTGCATTCTGAAGTAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025905.2-994s1c1
Sequence:CCGGGCTGTCGTTTGCACAGTTGTACTCGAGTACAACTGTGCAAACGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks