EMAIL THIS PAGE TO A FRIEND

TTC23L

tetratricopeptide repeat domain 23-like

Synonyms: MC25-1
UniProtKB ID: Q6PF05, Q6RGS4, Q8N7R3, Q96LJ2
Gene ID:
Mouse(75777) tetratricopeptide repeat domain 23-like
Rat(502510) tetratricopeptide repeat domain 23-like
cow(783234) tetratricopeptide repeat domain 23-like
sheep(101118135) tetratricopeptide repeat domain 23-like
domestic guinea pig(100722902) tetratricopeptide repeat domain 23-like
naked mole-rat(101717759) tetratricopeptide repeat domain 23-like
domestic cat(101098438) tetratricopeptide repeat domain 23-like
dog(479367) tetratricopeptide repeat domain 23-like
149 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144725 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144725 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144725 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029430 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029430 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029430 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144725 Rosetta Predictions human pricing
XM_001060041 Rosetta Predictions rat pricing
XM_577993 Rosetta Predictions rat pricing
XM_001473599 Rosetta Predictions mouse pricing
XM_897217 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082396 predicted 535
2 SASI_Hs01_00082397 predicted 322
3 SASI_Hs02_00364676 predicted 949
4 SASI_Hs02_00364677 predicted 288
5 SASI_Hs02_00364678 predicted 484
6 SASI_Hs01_00082398 predicted 672
7 SASI_Hs01_00082399 predicted 386
8 SASI_Hs01_00082400 predicted 538
9 SASI_Hs01_00082401 predicted 810
10 SASI_Hs01_00082403 predicted 452
11 SASI_Hs01_00082402 predicted 215
12 SASI_Hs01_00082404 predicted 591
13 SASI_Hs01_00082405 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060041 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295182 predicted 1170
2 SASI_Rn02_00295183 predicted 332
3 SASI_Rn02_00295184 predicted 1240
4 SASI_Rn02_00295185 predicted 618
5 SASI_Rn02_00295186 predicted 833
6 SASI_Rn02_00295187 predicted 317
7 SASI_Rn02_00295188 predicted 724
8 SASI_Rn02_00295189 predicted 323
9 SASI_Rn02_00295190 predicted 593
10 SASI_Rn02_00295191 predicted 1279
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577993 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00407428 predicted 1166
2 SASI_Rn02_00407429 predicted 329
3 SASI_Rn02_00407430 predicted 1236
4 SASI_Rn02_00407431 predicted 620
5 SASI_Rn02_00407432 predicted 827
6 SASI_Rn02_00407433 predicted 316
7 SASI_Rn02_00407434 predicted 731
8 SASI_Rn02_00407435 predicted 320
9 SASI_Rn02_00407436 predicted 596
10 SASI_Rn02_00407437 predicted 1282
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001473599 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00369259 predicted 1192
2 SASI_Mm02_00369260 predicted 893
3 SASI_Mm02_00369261 predicted 1088
4 SASI_Mm02_00369262 predicted 755
5 SASI_Mm02_00369263 predicted 612
6 SASI_Mm02_00369264 predicted 694
7 SASI_Mm02_00369265 predicted 586
8 SASI_Mm02_00369266 predicted 1230
9 SASI_Mm02_00369267 predicted 1248
10 SASI_Mm02_00369268 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897217 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00429833 predicted 414
2 SASI_Mm02_00429834 predicted 485
3 SASI_Mm02_00429835 predicted 1064
4 SASI_Mm02_00429836 predicted 476
5 SASI_Mm02_00429837 predicted 422
6 SASI_Mm02_00429838 predicted 395
7 SASI_Mm01_00252296 predicted 1069
8 SASI_Mm02_00429839 predicted 466
9 SASI_Mm02_00429840 predicted 485
10 SASI_Mm02_00429841 predicted 480
11 SASI_Mm01_00252289 predicted 1280
12 SASI_Mm01_00252290 predicted 1284
13 SASI_Mm01_00252291 predicted 987
14 SASI_Mm01_00252292 predicted 1187
15 SASI_Mm01_00252293 predicted 1026
16 SASI_Mm01_00252294 predicted 1301
17 SASI_Mm01_00252295 predicted 1324
18 SASI_Mm01_00252297 predicted 1008
19 SASI_Mm01_00252298 predicted 1341
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144725
TTC23L MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 23-like
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144725.2-1127s1c1
Sequence:CCGGCAATGCATATCGAGCAACATTCTCGAGAATGTTGCTCGATATGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144725.2-343s1c1
Sequence:CCGGCCAAAGAGAAATTAGCCCAATCTCGAGATTGGGCTAATTTCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144725.2-342s1c1
Sequence:CCGGCCCAAAGAGAAATTAGCCCAACTCGAGTTGGGCTAATTTCTCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144725.2-549s1c1
Sequence:CCGGCATGCTACATCAGCCAAGAATCTCGAGATTCTTGGCTGATGTAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144725.2-408s1c1
Sequence:CCGGCAAGCAAACAAGGAGCTGATTCTCGAGAATCAGCTCCTTGTTTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144725.3-444s21c1
Sequence:CCGGCTCTGGCCAACCTAGCTTATGCTCGAGCATAAGCTAGGTTGGCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144725.3-390s21c1
Sequence:CCGGGTGTCATCCTTTCTCGGATTACTCGAGTAATCCGAGAAAGGATGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144725.3-792s21c1
Sequence:CCGGACCTAGCTCTGGCATACTTTGCTCGAGCAAAGTATGCCAGAGCTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144725.3-328s21c1
Sequence:CCGGGAAAGTAGCTCAGCTGATTAACTCGAGTTAATCAGCTGAGCTACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144725.3-544s21c1
Sequence:CCGGGGCAAATACGACCTCAAATAACTCGAGTTATTTGAGGTCGTATTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144725.3-1049s21c1
Sequence:CCGGAGGGATGCTGTTGAGATATATCTCGAGATATATCTCAACAGCATCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144725
TTC23L MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 23-like
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144725.2-1127s1c1
Sequence:CCGGCAATGCATATCGAGCAACATTCTCGAGAATGTTGCTCGATATGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144725.2-343s1c1
Sequence:CCGGCCAAAGAGAAATTAGCCCAATCTCGAGATTGGGCTAATTTCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144725.2-342s1c1
Sequence:CCGGCCCAAAGAGAAATTAGCCCAACTCGAGTTGGGCTAATTTCTCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144725.2-549s1c1
Sequence:CCGGCATGCTACATCAGCCAAGAATCTCGAGATTCTTGGCTGATGTAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144725.2-408s1c1
Sequence:CCGGCAAGCAAACAAGGAGCTGATTCTCGAGAATCAGCTCCTTGTTTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144725.3-444s21c1
Sequence:CCGGCTCTGGCCAACCTAGCTTATGCTCGAGCATAAGCTAGGTTGGCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144725.3-390s21c1
Sequence:CCGGGTGTCATCCTTTCTCGGATTACTCGAGTAATCCGAGAAAGGATGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144725.3-792s21c1
Sequence:CCGGACCTAGCTCTGGCATACTTTGCTCGAGCAAAGTATGCCAGAGCTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144725.3-328s21c1
Sequence:CCGGGAAAGTAGCTCAGCTGATTAACTCGAGTTAATCAGCTGAGCTACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144725.3-544s21c1
Sequence:CCGGGGCAAATACGACCTCAAATAACTCGAGTTATTTGAGGTCGTATTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144725.3-1049s21c1
Sequence:CCGGAGGGATGCTGTTGAGATATATCTCGAGATATATCTCAACAGCATCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144725
TTC23L MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 23-like
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144725.2-1127s1c1
Sequence:CCGGCAATGCATATCGAGCAACATTCTCGAGAATGTTGCTCGATATGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144725.2-343s1c1
Sequence:CCGGCCAAAGAGAAATTAGCCCAATCTCGAGATTGGGCTAATTTCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144725.2-342s1c1
Sequence:CCGGCCCAAAGAGAAATTAGCCCAACTCGAGTTGGGCTAATTTCTCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144725.2-549s1c1
Sequence:CCGGCATGCTACATCAGCCAAGAATCTCGAGATTCTTGGCTGATGTAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144725.2-408s1c1
Sequence:CCGGCAAGCAAACAAGGAGCTGATTCTCGAGAATCAGCTCCTTGTTTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144725.3-444s21c1
Sequence:CCGGCTCTGGCCAACCTAGCTTATGCTCGAGCATAAGCTAGGTTGGCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144725.3-390s21c1
Sequence:CCGGGTGTCATCCTTTCTCGGATTACTCGAGTAATCCGAGAAAGGATGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144725.3-792s21c1
Sequence:CCGGACCTAGCTCTGGCATACTTTGCTCGAGCAAAGTATGCCAGAGCTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144725.3-328s21c1
Sequence:CCGGGAAAGTAGCTCAGCTGATTAACTCGAGTTAATCAGCTGAGCTACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144725.3-544s21c1
Sequence:CCGGGGCAAATACGACCTCAAATAACTCGAGTTATTTGAGGTCGTATTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144725.3-1049s21c1
Sequence:CCGGAGGGATGCTGTTGAGATATATCTCGAGATATATCTCAACAGCATCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029430
TTC23L MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 23-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029430.1-431s21c1
Sequence:CCGGTGCTGACCTGGAAGCGAAATACTCGAGTATTTCGCTTCCAGGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029430.1-714s21c1
Sequence:CCGGGAAGGCAATCTGCGATGTTATCTCGAGATAACATCGCAGATTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029430.1-488s21c1
Sequence:CCGGCTCTGGTCAGACTCTACTATACTCGAGTATAGTAGAGTCTGACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029430.1-1415s21c1
Sequence:CCGGCAACCAGTGAGCCGACAATTTCTCGAGAAATTGTCGGCTCACTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029430.1-765s21c1
Sequence:CCGGGATTAGTTTGTACGAAGAAATCTCGAGATTTCTTCGTACAAACTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029430
TTC23L MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 23-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029430.1-431s21c1
Sequence:CCGGTGCTGACCTGGAAGCGAAATACTCGAGTATTTCGCTTCCAGGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029430.1-714s21c1
Sequence:CCGGGAAGGCAATCTGCGATGTTATCTCGAGATAACATCGCAGATTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029430.1-488s21c1
Sequence:CCGGCTCTGGTCAGACTCTACTATACTCGAGTATAGTAGAGTCTGACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029430.1-1415s21c1
Sequence:CCGGCAACCAGTGAGCCGACAATTTCTCGAGAAATTGTCGGCTCACTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029430.1-765s21c1
Sequence:CCGGGATTAGTTTGTACGAAGAAATCTCGAGATTTCTTCGTACAAACTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029430
TTC23L MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 23-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029430.1-431s21c1
Sequence:CCGGTGCTGACCTGGAAGCGAAATACTCGAGTATTTCGCTTCCAGGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029430.1-714s21c1
Sequence:CCGGGAAGGCAATCTGCGATGTTATCTCGAGATAACATCGCAGATTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029430.1-488s21c1
Sequence:CCGGCTCTGGTCAGACTCTACTATACTCGAGTATAGTAGAGTCTGACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029430.1-1415s21c1
Sequence:CCGGCAACCAGTGAGCCGACAATTTCTCGAGAAATTGTCGGCTCACTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029430.1-765s21c1
Sequence:CCGGGATTAGTTTGTACGAAGAAATCTCGAGATTTCTTCGTACAAACTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks