EMAIL THIS PAGE TO A FRIEND

TTC24

tetratricopeptide repeat domain 24

UniProtKB ID: A2A3L6, Q5T3H7
Gene ID:
Mouse(214191) tetratricopeptide repeat domain 24
Rat(100361582) tetratricopeptide repeat domain 24
domestic cat(101084163) tetratricopeptide repeat domain 24
dog(480122) tetratricopeptide repeat domain 24
naked mole-rat(101716974) tetratricopeptide repeat domain 24
domestic guinea pig(100712944) tetratricopeptide repeat domain 24
cow(618203) tetratricopeptide repeat domain 24
sheep(101108713) tetratricopeptide repeat domain 24
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001105669 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001105669 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001105669 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172526 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172526 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172526 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU159461 MISSION® esiRNA esiRNA human TTC24 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105669 Rosetta Predictions human pricing
XM_089384 Rosetta Predictions human pricing
NM_172526 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105669 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324648 predicted 539
2 SASI_Hs02_00324649 predicted 456
3 SASI_Hs02_00324650 predicted 1228
4 SASI_Hs02_00324651 predicted 1305
5 SASI_Hs02_00324652 predicted 1283
6 SASI_Hs02_00324653 predicted 547
7 SASI_Hs02_00324654 predicted 1348
8 SASI_Hs02_00324655 predicted 545
9 SASI_Hs02_00324656 predicted 406
10 SASI_Hs02_00324657 predicted 1126
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_089384 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00292772 predicted 1247
2 SASI_Hs01_00292773 predicted 1154
3 SASI_Hs01_00292774 predicted 408
4 SASI_Hs01_00292775 predicted 1780
5 SASI_Hs01_00292776 predicted 1655
6 SASI_Hs01_00292777 predicted 1650
7 SASI_Hs01_00292778 predicted 1631
8 SASI_Hs01_00292779 predicted 1547
9 SASI_Hs01_00292780 predicted 542
10 SASI_Hs01_00292781 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172526 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149020 predicted 1504
2 SASI_Mm01_00149021 predicted 634
3 SASI_Mm01_00149022 predicted 1290
4 SASI_Mm01_00149023 predicted 1653
5 SASI_Mm02_00344125 predicted 1321
6 SASI_Mm01_00149024 predicted 1540
7 SASI_Mm01_00149025 predicted 969
8 SASI_Mm01_00149027 predicted 1827
9 SASI_Mm01_00149028 predicted 1139
10 SASI_Mm02_00344126 predicted 1136
11 SASI_Mm01_00149019 predicted 881
12 SASI_Mm01_00149026 predicted 1714
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001105669
TTC24 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 24
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105669.1-1415s21c1
Sequence:CCGGACATGAGAAATGAGGATATAACTCGAGTTATATCCTCATTTCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105669.1-166s21c1
Sequence:CCGGATCAGGAAGCTCGGGAGTTTCCTCGAGGAAACTCCCGAGCTTCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105669.1-1024s21c1
Sequence:CCGGAGTCGGGCATCTGCACTATTGCTCGAGCAATAGTGCAGATGCCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105669.1-411s21c1
Sequence:CCGGCAGGCCTTGAAGTACTATAAGCTCGAGCTTATAGTACTTCAAGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105669.1-850s21c1
Sequence:CCGGTCGGCAAAGCCTCCATCTATACTCGAGTATAGATGGAGGCTTTGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001105669
TTC24 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 24
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105669.1-1415s21c1
Sequence:CCGGACATGAGAAATGAGGATATAACTCGAGTTATATCCTCATTTCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105669.1-166s21c1
Sequence:CCGGATCAGGAAGCTCGGGAGTTTCCTCGAGGAAACTCCCGAGCTTCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105669.1-1024s21c1
Sequence:CCGGAGTCGGGCATCTGCACTATTGCTCGAGCAATAGTGCAGATGCCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105669.1-411s21c1
Sequence:CCGGCAGGCCTTGAAGTACTATAAGCTCGAGCTTATAGTACTTCAAGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105669.1-850s21c1
Sequence:CCGGTCGGCAAAGCCTCCATCTATACTCGAGTATAGATGGAGGCTTTGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001105669
TTC24 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 24
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105669.1-1415s21c1
Sequence:CCGGACATGAGAAATGAGGATATAACTCGAGTTATATCCTCATTTCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105669.1-166s21c1
Sequence:CCGGATCAGGAAGCTCGGGAGTTTCCTCGAGGAAACTCCCGAGCTTCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105669.1-1024s21c1
Sequence:CCGGAGTCGGGCATCTGCACTATTGCTCGAGCAATAGTGCAGATGCCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105669.1-411s21c1
Sequence:CCGGCAGGCCTTGAAGTACTATAAGCTCGAGCTTATAGTACTTCAAGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105669.1-850s21c1
Sequence:CCGGTCGGCAAAGCCTCCATCTATACTCGAGTATAGATGGAGGCTTTGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172526
TTC24 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 24
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172526.1-2102s1c1
Sequence:CCGGCCCTGAACACTTATAGGTATTCTCGAGAATACCTATAAGTGTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172526.1-1299s1c1
Sequence:CCGGGCAGACTTCACGGAAGGCAAACTCGAGTTTGCCTTCCGTGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172526.1-875s1c1
Sequence:CCGGACAATGTCCTTGGCAACTATTCTCGAGAATAGTTGCCAAGGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172526.1-1137s1c1
Sequence:CCGGCCAGGCCTTGAAATACTATAACTCGAGTTATAGTATTTCAAGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172526.1-730s1c1
Sequence:CCGGCTAGGGCCATTCTACAATGATCTCGAGATCATTGTAGAATGGCCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172526
TTC24 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 24
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172526.1-2102s1c1
Sequence:CCGGCCCTGAACACTTATAGGTATTCTCGAGAATACCTATAAGTGTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172526.1-1299s1c1
Sequence:CCGGGCAGACTTCACGGAAGGCAAACTCGAGTTTGCCTTCCGTGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172526.1-875s1c1
Sequence:CCGGACAATGTCCTTGGCAACTATTCTCGAGAATAGTTGCCAAGGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172526.1-1137s1c1
Sequence:CCGGCCAGGCCTTGAAATACTATAACTCGAGTTATAGTATTTCAAGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172526.1-730s1c1
Sequence:CCGGCTAGGGCCATTCTACAATGATCTCGAGATCATTGTAGAATGGCCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172526
TTC24 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 24
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172526.1-2102s1c1
Sequence:CCGGCCCTGAACACTTATAGGTATTCTCGAGAATACCTATAAGTGTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172526.1-1299s1c1
Sequence:CCGGGCAGACTTCACGGAAGGCAAACTCGAGTTTGCCTTCCGTGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172526.1-875s1c1
Sequence:CCGGACAATGTCCTTGGCAACTATTCTCGAGAATAGTTGCCAAGGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172526.1-1137s1c1
Sequence:CCGGCCAGGCCTTGAAATACTATAACTCGAGTTATAGTATTTCAAGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172526.1-730s1c1
Sequence:CCGGCTAGGGCCATTCTACAATGATCTCGAGATCATTGTAGAATGGCCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks