EMAIL THIS PAGE TO A FRIEND

TTC25

tetratricopeptide repeat domain 25

UniProtKB ID: Q96NG3, Q6NX40, Q6PJ04, Q9H0K5
Gene ID:
Mouse(74407) tetratricopeptide repeat domain 25
Rat(303534) tetratricopeptide repeat domain 25
cow(788831) tetratricopeptide repeat domain 25
sheep(101109466) tetratricopeptide repeat domain 25
domestic guinea pig(100715681) tetratricopeptide repeat domain 25
naked mole-rat(101701193) tetratricopeptide repeat domain 25
Domestic Rabbit(100342400) tetratricopeptide repeat domain 25
Zebrafish(393286) tetratricopeptide repeat domain 25
chicken(100857899) tetratricopeptide repeat domain 25
domestic cat(101089911) tetratricopeptide repeat domain 25
Horse(100066429) tetratricopeptide repeat domain 25
dog(490973) tetratricopeptide repeat domain 25
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031421 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031421 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031421 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028918 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028918 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028918 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031421 Rosetta Predictions human pricing
NM_001107049 Rosetta Predictions rat pricing
NM_028918 Rosetta Predictions mouse pricing
XM_126529 Rosetta Predictions mouse pricing
XM_903052 Rosetta Predictions mouse pricing
XM_903053 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031421 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109909 predicted 715
2 SASI_Hs01_00109910 predicted 973
3 SASI_Hs01_00109911 predicted 1577
4 SASI_Hs01_00109912 predicted 376
5 SASI_Hs01_00109914 predicted 1480
6 SASI_Hs02_00358808 predicted 920
7 SASI_Hs01_00109915 predicted 1174
8 SASI_Hs01_00109916 predicted 381
9 SASI_Hs01_00109917 predicted 768
10 SASI_Hs02_00358809 predicted 400
11 SASI_Hs01_00109908 predicted 1114
12 SASI_Hs01_00109913 predicted 1600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107049 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224986 predicted 1936
2 SASI_Rn02_00224987 predicted 1270
3 SASI_Rn02_00224988 predicted 1201
4 SASI_Rn02_00224989 predicted 458
5 SASI_Rn02_00224990 predicted 937
6 SASI_Rn02_00224991 predicted 1247
7 SASI_Rn02_00224992 predicted 1946
8 SASI_Rn02_00224993 predicted 301
9 SASI_Rn02_00224994 predicted 440
10 SASI_Rn02_00224995 predicted 1881
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028918 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334596 predicted 1312
2 SASI_Mm02_00334597 predicted 337
3 SASI_Mm02_00334598 predicted 1249
4 SASI_Mm02_00334599 predicted 248
5 SASI_Mm02_00334600 predicted 406
6 SASI_Mm02_00334601 predicted 626
7 SASI_Mm02_00334602 predicted 1297
8 SASI_Mm02_00334603 predicted 361
9 SASI_Mm02_00334604 predicted 982
10 SASI_Mm02_00334605 predicted 2076
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_126529 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00220756 predicted 1559
2 SASI_Mm01_00220757 predicted 816
3 SASI_Mm01_00220758 predicted 512
4 SASI_Mm01_00220759 predicted 288
5 SASI_Mm01_00220760 predicted 437
6 SASI_Mm01_00220761 predicted 665
7 SASI_Mm01_00220762 predicted 386
8 SASI_Mm01_00220763 predicted 1012
9 SASI_Mm01_00220764 predicted 858
10 SASI_Mm01_00220765 predicted 1653
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903052 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225338 predicted 462
2 SASI_Mm01_00225339 predicted 505
3 SASI_Mm01_00225340 predicted 282
4 SASI_Mm01_00225341 predicted 446
5 SASI_Mm01_00225342 predicted 654
6 SASI_Mm01_00225343 predicted 659
7 SASI_Mm01_00225344 predicted 393
8 SASI_Mm01_00225345 predicted 1081
9 SASI_Mm01_00225346 predicted 1018
10 SASI_Mm01_00225347 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903053 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00285963 predicted 461
2 SASI_Mm01_00285964 predicted 514
3 SASI_Mm01_00285965 predicted 286
4 SASI_Mm01_00285966 predicted 444
5 SASI_Mm01_00285967 predicted 653
6 SASI_Mm01_00285968 predicted 660
7 SASI_Mm01_00285969 predicted 395
8 SASI_Mm01_00285970 predicted 1085
9 SASI_Mm01_00285971 predicted 1017
10 SASI_Mm01_00285972 predicted 859
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031421
TTC25 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 25
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031421.1-1520s1c1
Sequence:CCGGCGATGCCAACAAGGGTATCATCTCGAGATGATACCCTTGTTGGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031421.1-170s1c1
Sequence:CCGGGAGCTTCAGCAACGCTCTTTACTCGAGTAAAGAGCGTTGCTGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031421.1-1373s1c1
Sequence:CCGGGCAACTGAATGCCAGTGTTCTCTCGAGAGAACACTGGCATTCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031421.1-1825s1c1
Sequence:CCGGCAGGAGAATTAGGCACAAGATCTCGAGATCTTGTGCCTAATTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031421.1-899s1c1
Sequence:CCGGCCTGGAGGACATTGATATGTTCTCGAGAACATATCAATGTCCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031421.1-1926s1c1
Sequence:CCGGGAGCAAAGACTCTCAGGAGAACTCGAGTTCTCCTGAGAGTCTTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031421.1-695s1c1
Sequence:CCGGCCTGATCAAAGGCACCATGAACTCGAGTTCATGGTGCCTTTGATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031421.2-1447s21c1
Sequence:CCGGTCGAGTCAGCCGTGAACAATTCTCGAGAATTGTTCACGGCTGACTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031421.2-361s21c1
Sequence:CCGGTGTACACCATGGGAGACTTTGCTCGAGCAAAGTCTCCCATGGTGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031421
TTC25 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 25
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031421.1-1520s1c1
Sequence:CCGGCGATGCCAACAAGGGTATCATCTCGAGATGATACCCTTGTTGGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031421.1-170s1c1
Sequence:CCGGGAGCTTCAGCAACGCTCTTTACTCGAGTAAAGAGCGTTGCTGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031421.1-1373s1c1
Sequence:CCGGGCAACTGAATGCCAGTGTTCTCTCGAGAGAACACTGGCATTCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031421.1-1825s1c1
Sequence:CCGGCAGGAGAATTAGGCACAAGATCTCGAGATCTTGTGCCTAATTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031421.1-899s1c1
Sequence:CCGGCCTGGAGGACATTGATATGTTCTCGAGAACATATCAATGTCCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031421.1-1926s1c1
Sequence:CCGGGAGCAAAGACTCTCAGGAGAACTCGAGTTCTCCTGAGAGTCTTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031421.1-695s1c1
Sequence:CCGGCCTGATCAAAGGCACCATGAACTCGAGTTCATGGTGCCTTTGATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031421.2-1447s21c1
Sequence:CCGGTCGAGTCAGCCGTGAACAATTCTCGAGAATTGTTCACGGCTGACTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031421.2-361s21c1
Sequence:CCGGTGTACACCATGGGAGACTTTGCTCGAGCAAAGTCTCCCATGGTGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031421
TTC25 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 25
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031421.1-1520s1c1
Sequence:CCGGCGATGCCAACAAGGGTATCATCTCGAGATGATACCCTTGTTGGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031421.1-170s1c1
Sequence:CCGGGAGCTTCAGCAACGCTCTTTACTCGAGTAAAGAGCGTTGCTGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031421.1-1373s1c1
Sequence:CCGGGCAACTGAATGCCAGTGTTCTCTCGAGAGAACACTGGCATTCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031421.1-1825s1c1
Sequence:CCGGCAGGAGAATTAGGCACAAGATCTCGAGATCTTGTGCCTAATTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031421.1-899s1c1
Sequence:CCGGCCTGGAGGACATTGATATGTTCTCGAGAACATATCAATGTCCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031421.1-1926s1c1
Sequence:CCGGGAGCAAAGACTCTCAGGAGAACTCGAGTTCTCCTGAGAGTCTTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031421.1-695s1c1
Sequence:CCGGCCTGATCAAAGGCACCATGAACTCGAGTTCATGGTGCCTTTGATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031421.2-1447s21c1
Sequence:CCGGTCGAGTCAGCCGTGAACAATTCTCGAGAATTGTTCACGGCTGACTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031421.2-361s21c1
Sequence:CCGGTGTACACCATGGGAGACTTTGCTCGAGCAAAGTCTCCCATGGTGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028918
TTC25 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 25
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028918.2-471s21c1
Sequence:CCGGTCTATCATCGAGGCTACAAACCTCGAGGTTTGTAGCCTCGATGATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028918.2-820s21c1
Sequence:CCGGGACCGTGGAGGACCTCATTATCTCGAGATAATGAGGTCCTCCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028918.2-637s21c1
Sequence:CCGGACAGAAGCATCTGCCTATAAACTCGAGTTTATAGGCAGATGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028918.2-2614s21c1
Sequence:CCGGTCCTAGAGTTAGCGAATAAACCTCGAGGTTTATTCGCTAACTCTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028918.2-1241s21c1
Sequence:CCGGTCGAGAGCCCTTGACAATATTCTCGAGAATATTGTCAAGGGCTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028918
TTC25 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 25
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028918.2-471s21c1
Sequence:CCGGTCTATCATCGAGGCTACAAACCTCGAGGTTTGTAGCCTCGATGATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028918.2-820s21c1
Sequence:CCGGGACCGTGGAGGACCTCATTATCTCGAGATAATGAGGTCCTCCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028918.2-637s21c1
Sequence:CCGGACAGAAGCATCTGCCTATAAACTCGAGTTTATAGGCAGATGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028918.2-2614s21c1
Sequence:CCGGTCCTAGAGTTAGCGAATAAACCTCGAGGTTTATTCGCTAACTCTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028918.2-1241s21c1
Sequence:CCGGTCGAGAGCCCTTGACAATATTCTCGAGAATATTGTCAAGGGCTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028918
TTC25 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 25
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028918.2-471s21c1
Sequence:CCGGTCTATCATCGAGGCTACAAACCTCGAGGTTTGTAGCCTCGATGATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028918.2-820s21c1
Sequence:CCGGGACCGTGGAGGACCTCATTATCTCGAGATAATGAGGTCCTCCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028918.2-637s21c1
Sequence:CCGGACAGAAGCATCTGCCTATAAACTCGAGTTTATAGGCAGATGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028918.2-2614s21c1
Sequence:CCGGTCCTAGAGTTAGCGAATAAACCTCGAGGTTTATTCGCTAACTCTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028918.2-1241s21c1
Sequence:CCGGTCGAGAGCCCTTGACAATATTCTCGAGAATATTGTCAAGGGCTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks