EMAIL THIS PAGE TO A FRIEND

TTC26

tetratricopeptide repeat domain 26

Synonyms: DYF13 dyf-13
Gene ID:
Mouse(264134) tetratricopeptide repeat domain 26
Rat(500086) tetratricopeptide repeat domain 26
Zebrafish(494074) tetratricopeptide repeat domain 26
domestic cat(101090091) tetratricopeptide repeat domain 26
dog(475530) tetratricopeptide repeat domain 26
chicken(417969) tetratricopeptide repeat domain 26
naked mole-rat(101721723) tetratricopeptide repeat domain 26
domestic guinea pig(100733439) tetratricopeptide repeat domain 26
cow(508011) tetratricopeptide repeat domain 26
sheep(101104570) tetratricopeptide repeat domain 26
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024926 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024926 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024926 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153600 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153600 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153600 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024926 Rosetta Predictions human pricing
NM_001025045 Rosetta Predictions rat pricing
NM_153600 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142265 predicted 1487
2 SASI_Hs02_00357550 predicted 1072
3 SASI_Hs01_00142267 predicted 1128
4 SASI_Hs01_00142268 predicted 1009
5 SASI_Hs01_00142270 predicted 977
6 SASI_Hs02_00357551 predicted 196
7 SASI_Hs01_00142271 predicted 546
8 SASI_Hs01_00142272 predicted 672
9 SASI_Hs01_00142273 predicted 718
10 SASI_Hs01_00142274 predicted 1626
11 SASI_Hs01_00142266 predicted 1243
12 SASI_Hs01_00142269 predicted 1466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025045 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111760 predicted 583
2 SASI_Rn02_00202975 predicted 1103
3 SASI_Rn02_00202976 predicted 1033
4 SASI_Rn01_00111762 predicted 225
5 SASI_Rn01_00111763 predicted 1381
6 SASI_Rn01_00111764 predicted 1647
7 SASI_Rn02_00202977 predicted 692
8 SASI_Rn01_00111765 predicted 328
9 SASI_Rn01_00111766 predicted 775
10 SASI_Rn01_00111767 predicted 1754
11 SASI_Rn01_00111761 predicted 524
12 SASI_Rn01_00111768 predicted 684
13 SASI_Rn01_00111769 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153600 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343444 predicted 484
2 SASI_Mm02_00343445 predicted 1062
3 SASI_Mm02_00343446 predicted 1011
4 SASI_Mm02_00343447 predicted 1615
5 SASI_Mm02_00343448 predicted 552
6 SASI_Mm02_00343449 predicted 745
7 SASI_Mm02_00343450 predicted 832
8 SASI_Mm02_00343451 predicted 1759
9 SASI_Mm02_00343452 predicted 1280
10 SASI_Mm02_00343453 predicted 271
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024926
VALIDATED
TTC26 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 26
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024926.2-1249s21c1
Sequence:CCGGTTGATTTACCTCAACTCATTTCTCGAGAAATGAGTTGAGGTAAATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024926.2-225s21c1
Sequence:CCGGAGATTTCACTGGAGCTATTACCTCGAGGTAATAGCTCCAGTGAAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024926.2-636s21c1
Sequence:CCGGTAAGCGAATACTGCTAGATAACTCGAGTTATCTAGCAGTATTCGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024926.2-1447s21c1
Sequence:CCGGAGACTAGCCTGGGAACTTTATCTCGAGATAAAGTTCCCAGGCTAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024926.2-764s21c1
Sequence:CCGGATAGTACCATCGCACTCAATCCTCGAGGATTGAGTGCGATGGTACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024926.2-1171s21c1
Sequence:CCGGGCTAGTGAATGTGATACAATACTCGAGTATTGTATCACATTCACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024926.1-1924s1c1
Sequence:CCGGCCATAGTCTGTGACCCTGTATCTCGAGATACAGGGTCACAGACTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024926.1-1559s1c1
Sequence:CCGGCCCTGAATATTGGGAAGGCAACTCGAGTTGCCTTCCCAATATTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024926.1-1768s1c1
Sequence:CCGGCCAGCTTCTACTTTGACATAACTCGAGTTATGTCAAAGTAGAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024926.1-940s1c1
Sequence:CCGGCTAGGCTAAACTTGGTGATTTCTCGAGAAATCACCAAGTTTAGCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160500    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024926.1-1805s1c1
Sequence:CCGGCACTCCAGTTTAATCTGTGATCTCGAGATCACAGATTAAACTGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024926.1-1223s1c1
Sequence:CCGGCCTCAACTCATTTAAGAGTTACTCGAGTAACTCTTAAATGAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024926.1-1328s1c1
Sequence:CCGGCCTCTTGATCCAAAGTGAGAACTCGAGTTCTCACTTTGGATCAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162112    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024926.1-1938s1c1
Sequence:CCGGCCTGTATGATCCTAGTAGCAACTCGAGTTGCTACTAGGATCATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024926.1-365s1c1
Sequence:CCGGGAACCTAGCTTGCACCTACTTCTCGAGAAGTAGGTGCAAGCTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136861    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_024926.1-1760s1c1
Sequence:CCGGCCTAGGAACCAGCTTCTACTTCTCGAGAAGTAGAAGCTGGTTCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_024926.1-1383s1c1
Sequence:CCGGGCTCGGTGCTATATTATGAATCTCGAGATTCATAATATAGCACCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024926.1-1026s1c1
Sequence:CCGGCCTCAGGAGTATATTCTCAAACTCGAGTTTGAGAATATACTCCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024926
VALIDATED
TTC26 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 26
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024926.2-1249s21c1
Sequence:CCGGTTGATTTACCTCAACTCATTTCTCGAGAAATGAGTTGAGGTAAATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024926.2-225s21c1
Sequence:CCGGAGATTTCACTGGAGCTATTACCTCGAGGTAATAGCTCCAGTGAAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024926.2-636s21c1
Sequence:CCGGTAAGCGAATACTGCTAGATAACTCGAGTTATCTAGCAGTATTCGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024926.2-1447s21c1
Sequence:CCGGAGACTAGCCTGGGAACTTTATCTCGAGATAAAGTTCCCAGGCTAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024926.2-764s21c1
Sequence:CCGGATAGTACCATCGCACTCAATCCTCGAGGATTGAGTGCGATGGTACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024926.2-1171s21c1
Sequence:CCGGGCTAGTGAATGTGATACAATACTCGAGTATTGTATCACATTCACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024926.1-1924s1c1
Sequence:CCGGCCATAGTCTGTGACCCTGTATCTCGAGATACAGGGTCACAGACTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024926.1-1559s1c1
Sequence:CCGGCCCTGAATATTGGGAAGGCAACTCGAGTTGCCTTCCCAATATTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024926.1-1768s1c1
Sequence:CCGGCCAGCTTCTACTTTGACATAACTCGAGTTATGTCAAAGTAGAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024926.1-940s1c1
Sequence:CCGGCTAGGCTAAACTTGGTGATTTCTCGAGAAATCACCAAGTTTAGCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160500    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024926.1-1805s1c1
Sequence:CCGGCACTCCAGTTTAATCTGTGATCTCGAGATCACAGATTAAACTGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024926.1-1223s1c1
Sequence:CCGGCCTCAACTCATTTAAGAGTTACTCGAGTAACTCTTAAATGAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024926.1-1328s1c1
Sequence:CCGGCCTCTTGATCCAAAGTGAGAACTCGAGTTCTCACTTTGGATCAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162112    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024926.1-1938s1c1
Sequence:CCGGCCTGTATGATCCTAGTAGCAACTCGAGTTGCTACTAGGATCATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024926.1-365s1c1
Sequence:CCGGGAACCTAGCTTGCACCTACTTCTCGAGAAGTAGGTGCAAGCTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136861    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_024926.1-1760s1c1
Sequence:CCGGCCTAGGAACCAGCTTCTACTTCTCGAGAAGTAGAAGCTGGTTCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_024926.1-1383s1c1
Sequence:CCGGGCTCGGTGCTATATTATGAATCTCGAGATTCATAATATAGCACCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024926.1-1026s1c1
Sequence:CCGGCCTCAGGAGTATATTCTCAAACTCGAGTTTGAGAATATACTCCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024926
VALIDATED
TTC26 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 26
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024926.2-1249s21c1
Sequence:CCGGTTGATTTACCTCAACTCATTTCTCGAGAAATGAGTTGAGGTAAATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024926.2-225s21c1
Sequence:CCGGAGATTTCACTGGAGCTATTACCTCGAGGTAATAGCTCCAGTGAAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024926.2-636s21c1
Sequence:CCGGTAAGCGAATACTGCTAGATAACTCGAGTTATCTAGCAGTATTCGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024926.2-1447s21c1
Sequence:CCGGAGACTAGCCTGGGAACTTTATCTCGAGATAAAGTTCCCAGGCTAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024926.2-764s21c1
Sequence:CCGGATAGTACCATCGCACTCAATCCTCGAGGATTGAGTGCGATGGTACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024926.2-1171s21c1
Sequence:CCGGGCTAGTGAATGTGATACAATACTCGAGTATTGTATCACATTCACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024926.1-1924s1c1
Sequence:CCGGCCATAGTCTGTGACCCTGTATCTCGAGATACAGGGTCACAGACTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024926.1-1559s1c1
Sequence:CCGGCCCTGAATATTGGGAAGGCAACTCGAGTTGCCTTCCCAATATTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024926.1-1768s1c1
Sequence:CCGGCCAGCTTCTACTTTGACATAACTCGAGTTATGTCAAAGTAGAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024926.1-940s1c1
Sequence:CCGGCTAGGCTAAACTTGGTGATTTCTCGAGAAATCACCAAGTTTAGCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160500    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024926.1-1805s1c1
Sequence:CCGGCACTCCAGTTTAATCTGTGATCTCGAGATCACAGATTAAACTGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024926.1-1223s1c1
Sequence:CCGGCCTCAACTCATTTAAGAGTTACTCGAGTAACTCTTAAATGAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024926.1-1328s1c1
Sequence:CCGGCCTCTTGATCCAAAGTGAGAACTCGAGTTCTCACTTTGGATCAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162112    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024926.1-1938s1c1
Sequence:CCGGCCTGTATGATCCTAGTAGCAACTCGAGTTGCTACTAGGATCATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024926.1-365s1c1
Sequence:CCGGGAACCTAGCTTGCACCTACTTCTCGAGAAGTAGGTGCAAGCTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136861    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_024926.1-1760s1c1
Sequence:CCGGCCTAGGAACCAGCTTCTACTTCTCGAGAAGTAGAAGCTGGTTCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_024926.1-1383s1c1
Sequence:CCGGGCTCGGTGCTATATTATGAATCTCGAGATTCATAATATAGCACCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024926.1-1026s1c1
Sequence:CCGGCCTCAGGAGTATATTCTCAAACTCGAGTTTGAGAATATACTCCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153600
TTC26 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 26
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153600.2-1124s1c1
Sequence:CCGGGCTAGTGAATGTGATACAATACTCGAGTATTGTATCACATTCACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153600.2-747s1c1
Sequence:CCGGGCAATCACTTTCGCCTTTATACTCGAGTATAAAGGCGAAAGTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153600.2-3674s1c1
Sequence:CCGGGCTTCCTGAAAGACACTCATTCTCGAGAATGAGTGTCTTTCAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153600.2-1019s1c1
Sequence:CCGGGAGTATATCCTCAAGGGAGTTCTCGAGAACTCCCTTGAGGATATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153600.2-3019s1c1
Sequence:CCGGGCTTGTTTGTATGCTCTGTAACTCGAGTTACAGAGCATACAAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153600.2-1370s1c1
Sequence:CCGGGCTCGCTGCTATATTATGAATCTCGAGATTCATAATATAGCAGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153600.2-236s1c1
Sequence:CCGGGACGACACTAACTTATGGATTCTCGAGAATCCATAAGTTAGTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153600
TTC26 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 26
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153600.2-1124s1c1
Sequence:CCGGGCTAGTGAATGTGATACAATACTCGAGTATTGTATCACATTCACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153600.2-747s1c1
Sequence:CCGGGCAATCACTTTCGCCTTTATACTCGAGTATAAAGGCGAAAGTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153600.2-3674s1c1
Sequence:CCGGGCTTCCTGAAAGACACTCATTCTCGAGAATGAGTGTCTTTCAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153600.2-1019s1c1
Sequence:CCGGGAGTATATCCTCAAGGGAGTTCTCGAGAACTCCCTTGAGGATATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153600.2-3019s1c1
Sequence:CCGGGCTTGTTTGTATGCTCTGTAACTCGAGTTACAGAGCATACAAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153600.2-1370s1c1
Sequence:CCGGGCTCGCTGCTATATTATGAATCTCGAGATTCATAATATAGCAGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153600.2-236s1c1
Sequence:CCGGGACGACACTAACTTATGGATTCTCGAGAATCCATAAGTTAGTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153600
TTC26 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 26
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153600.2-1124s1c1
Sequence:CCGGGCTAGTGAATGTGATACAATACTCGAGTATTGTATCACATTCACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153600.2-747s1c1
Sequence:CCGGGCAATCACTTTCGCCTTTATACTCGAGTATAAAGGCGAAAGTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153600.2-3674s1c1
Sequence:CCGGGCTTCCTGAAAGACACTCATTCTCGAGAATGAGTGTCTTTCAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153600.2-1019s1c1
Sequence:CCGGGAGTATATCCTCAAGGGAGTTCTCGAGAACTCCCTTGAGGATATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153600.2-3019s1c1
Sequence:CCGGGCTTGTTTGTATGCTCTGTAACTCGAGTTACAGAGCATACAAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153600.2-1370s1c1
Sequence:CCGGGCTCGCTGCTATATTATGAATCTCGAGATTCATAATATAGCAGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153600.2-236s1c1
Sequence:CCGGGACGACACTAACTTATGGATTCTCGAGAATCCATAAGTTAGTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks