EMAIL THIS PAGE TO A FRIEND

TTC27

tetratricopeptide repeat domain 27

UniProtKB ID: Q6P3X3, A6NKJ0, Q96SS5, Q9BVF1, Q9NWR4, Q9NXG4
Gene ID:
Mouse(74196) tetratricopeptide repeat domain 27
Rat(298782) tetratricopeptide repeat domain 27
cow(524908) tetratricopeptide repeat domain 27
sheep(101103388) tetratricopeptide repeat domain 27
domestic guinea pig(100733050) tetratricopeptide repeat domain 27
naked mole-rat(101714933) tetratricopeptide repeat domain 27
Domestic Rabbit(100342184) tetratricopeptide repeat domain 27
Zebrafish(317640) tetratricopeptide repeat domain 27
Horse(100054467) tetratricopeptide repeat domain 27
domestic cat(101085710) tetratricopeptide repeat domain 27
dog(475719) tetratricopeptide repeat domain 27
chicken(421462) tetratricopeptide repeat domain 27
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017735 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017735 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017735 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_152817 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_152817 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_152817 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017735 Rosetta Predictions human pricing
NM_001106706 Rosetta Predictions rat pricing
NM_152817 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350521 predicted 1678
2 SASI_Hs02_00350522 predicted 1215
3 SASI_Hs01_00051679 predicted 2361
4 SASI_Hs01_00051681 predicted 656
5 SASI_Hs01_00051682 predicted 473
6 SASI_Hs01_00051683 predicted 755
7 SASI_Hs01_00051684 predicted 1563
8 SASI_Hs02_00350523 predicted 1410
9 SASI_Hs01_00051685 predicted 448
10 SASI_Hs02_00350524 predicted 1550
11 SASI_Hs01_00051678 predicted 2042
12 SASI_Hs01_00051680 predicted 871
13 SASI_Hs01_00051686 predicted 1003
14 SASI_Hs01_00051687 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106706 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221588 predicted 2526
2 SASI_Rn02_00221589 predicted 1980
3 SASI_Rn02_00221590 predicted 299
4 SASI_Rn02_00221591 predicted 2275
5 SASI_Rn02_00221592 predicted 807
6 SASI_Rn02_00221593 predicted 878
7 SASI_Rn02_00221594 predicted 2156
8 SASI_Rn02_00221595 predicted 951
9 SASI_Rn02_00221596 predicted 555
10 SASI_Rn02_00221597 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152817 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124119 predicted 1118
2 SASI_Mm01_00124120 predicted 1822
3 SASI_Mm01_00124122 predicted 310
4 SASI_Mm01_00124123 predicted 747
5 SASI_Mm01_00124124 predicted 1232
6 SASI_Mm01_00124125 predicted 1977
7 SASI_Mm01_00124126 predicted 1780
8 SASI_Mm02_00342827 predicted 1095
9 SASI_Mm01_00124127 predicted 2386
10 SASI_Mm01_00124128 predicted 389
11 SASI_Mm01_00124121 predicted 1937
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017735
VALIDATED
TTC27 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 27
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017735.3-447s1c1
Sequence:CCGGGCAGGTAGTAACATTCCTGGACTCGAGTCCAGGAATGTTACTACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017735.3-2727s1c1
Sequence:CCGGCCAAGACCTAAGCAACCAGTTCTCGAGAACTGGTTGCTTAGGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017735.3-312s1c1
Sequence:CCGGCGGTTCAGAGAGTGGATCTTTCTCGAGAAAGATCCACTCTCTGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017735.3-1144s1c1
Sequence:CCGGCCCACTCCTCAGGAACATTTACTCGAGTAAATGTTCCTGAGGAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017735.3-2768s1c1
Sequence:CCGGGCTGGAAGCAGATTCTGGAAACTCGAGTTTCCAGAATCTGCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017735.3-1471s1c1
Sequence:CCGGGCAGACCAATTTGAAGATAAACTCGAGTTTATCTTCAAATTGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017735.3-2471s1c1
Sequence:CCGGCCAATTGTTGGGAGAAAGATACTCGAGTATCTTTCTCCCAACAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017735.3-1252s1c1
Sequence:CCGGGCTGAAGAGATCGCTATTATTCTCGAGAATAATAGCGATCTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017735.3-491s1c1
Sequence:CCGGCGGAAAGACAACAGTTGATATCTCGAGATATCAACTGTTGTCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017735
VALIDATED
TTC27 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 27
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017735.3-447s1c1
Sequence:CCGGGCAGGTAGTAACATTCCTGGACTCGAGTCCAGGAATGTTACTACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017735.3-2727s1c1
Sequence:CCGGCCAAGACCTAAGCAACCAGTTCTCGAGAACTGGTTGCTTAGGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017735.3-312s1c1
Sequence:CCGGCGGTTCAGAGAGTGGATCTTTCTCGAGAAAGATCCACTCTCTGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017735.3-1144s1c1
Sequence:CCGGCCCACTCCTCAGGAACATTTACTCGAGTAAATGTTCCTGAGGAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017735.3-2768s1c1
Sequence:CCGGGCTGGAAGCAGATTCTGGAAACTCGAGTTTCCAGAATCTGCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017735.3-1471s1c1
Sequence:CCGGGCAGACCAATTTGAAGATAAACTCGAGTTTATCTTCAAATTGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017735.3-2471s1c1
Sequence:CCGGCCAATTGTTGGGAGAAAGATACTCGAGTATCTTTCTCCCAACAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017735.3-1252s1c1
Sequence:CCGGGCTGAAGAGATCGCTATTATTCTCGAGAATAATAGCGATCTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017735.3-491s1c1
Sequence:CCGGCGGAAAGACAACAGTTGATATCTCGAGATATCAACTGTTGTCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017735
VALIDATED
TTC27 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 27
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017735.3-447s1c1
Sequence:CCGGGCAGGTAGTAACATTCCTGGACTCGAGTCCAGGAATGTTACTACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017735.3-2727s1c1
Sequence:CCGGCCAAGACCTAAGCAACCAGTTCTCGAGAACTGGTTGCTTAGGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017735.3-312s1c1
Sequence:CCGGCGGTTCAGAGAGTGGATCTTTCTCGAGAAAGATCCACTCTCTGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017735.3-1144s1c1
Sequence:CCGGCCCACTCCTCAGGAACATTTACTCGAGTAAATGTTCCTGAGGAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017735.3-2768s1c1
Sequence:CCGGGCTGGAAGCAGATTCTGGAAACTCGAGTTTCCAGAATCTGCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017735.3-1471s1c1
Sequence:CCGGGCAGACCAATTTGAAGATAAACTCGAGTTTATCTTCAAATTGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017735.3-2471s1c1
Sequence:CCGGCCAATTGTTGGGAGAAAGATACTCGAGTATCTTTCTCCCAACAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017735.3-1252s1c1
Sequence:CCGGGCTGAAGAGATCGCTATTATTCTCGAGAATAATAGCGATCTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017735.3-491s1c1
Sequence:CCGGCGGAAAGACAACAGTTGATATCTCGAGATATCAACTGTTGTCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152817
VALIDATED
TTC27 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 27
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152817.2-1109s1c1
Sequence:CCGGGCCAAGAATCTTGAGCTCAATCTCGAGATTGAGCTCAAGATTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152817.2-655s1c1
Sequence:CCGGGCTGCTAATAGCACGCATTATCTCGAGATAATGCGTGCTATTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152817.2-863s1c1
Sequence:CCGGGCTATTCAATTTCATCTGGAACTCGAGTTCCAGATGAAATTGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152817.4-1936s21c1
Sequence:CCGGGTGACCCTAGAACCCGATAATCTCGAGATTATCGGGTTCTAGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152817.4-1979s1c1
Sequence:CCGGCTACTTCCTATATTCGATTAACTCGAGTTAATCGAATATAGGAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152817.4-655s21c1
Sequence:CCGGCTGCTAATAGCACGCATTATCCTCGAGGATAATGCGTGCTATTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152817.4-1826s21c1
Sequence:CCGGAGCGCTCAGTGAAGATCAATCCTCGAGGATTGATCTTCACTGAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152817.4-1979s21c1
Sequence:CCGGCTACTTCCTATATTCGATTAACTCGAGTTAATCGAATATAGGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152817.4-1413s21c1
Sequence:CCGGTGCAGACCAATTCGAAGATAACTCGAGTTATCTTCGAATTGGTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152817
VALIDATED
TTC27 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 27
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152817.2-1109s1c1
Sequence:CCGGGCCAAGAATCTTGAGCTCAATCTCGAGATTGAGCTCAAGATTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152817.2-655s1c1
Sequence:CCGGGCTGCTAATAGCACGCATTATCTCGAGATAATGCGTGCTATTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152817.2-863s1c1
Sequence:CCGGGCTATTCAATTTCATCTGGAACTCGAGTTCCAGATGAAATTGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152817.4-1936s21c1
Sequence:CCGGGTGACCCTAGAACCCGATAATCTCGAGATTATCGGGTTCTAGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152817.4-1979s1c1
Sequence:CCGGCTACTTCCTATATTCGATTAACTCGAGTTAATCGAATATAGGAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152817.4-655s21c1
Sequence:CCGGCTGCTAATAGCACGCATTATCCTCGAGGATAATGCGTGCTATTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152817.4-1826s21c1
Sequence:CCGGAGCGCTCAGTGAAGATCAATCCTCGAGGATTGATCTTCACTGAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152817.4-1979s21c1
Sequence:CCGGCTACTTCCTATATTCGATTAACTCGAGTTAATCGAATATAGGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152817.4-1413s21c1
Sequence:CCGGTGCAGACCAATTCGAAGATAACTCGAGTTATCTTCGAATTGGTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152817
VALIDATED
TTC27 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 27
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152817.2-1109s1c1
Sequence:CCGGGCCAAGAATCTTGAGCTCAATCTCGAGATTGAGCTCAAGATTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152817.2-655s1c1
Sequence:CCGGGCTGCTAATAGCACGCATTATCTCGAGATAATGCGTGCTATTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152817.2-863s1c1
Sequence:CCGGGCTATTCAATTTCATCTGGAACTCGAGTTCCAGATGAAATTGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152817.4-1936s21c1
Sequence:CCGGGTGACCCTAGAACCCGATAATCTCGAGATTATCGGGTTCTAGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152817.4-1979s1c1
Sequence:CCGGCTACTTCCTATATTCGATTAACTCGAGTTAATCGAATATAGGAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152817.4-655s21c1
Sequence:CCGGCTGCTAATAGCACGCATTATCCTCGAGGATAATGCGTGCTATTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152817.4-1826s21c1
Sequence:CCGGAGCGCTCAGTGAAGATCAATCCTCGAGGATTGATCTTCACTGAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152817.4-1979s21c1
Sequence:CCGGCTACTTCCTATATTCGATTAACTCGAGTTAATCGAATATAGGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152817.4-1413s21c1
Sequence:CCGGTGCAGACCAATTCGAAGATAACTCGAGTTATCTTCGAATTGGTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks