EMAIL THIS PAGE TO A FRIEND

TTC28

tetratricopeptide repeat domain 28

Synonyms: TPRBK
Gene ID:
Mouse(209683) tetratricopeptide repeat domain 28
Rat(304558) tetratricopeptide repeat domain 28
Zebrafish(100331958) tetratricopeptide repeat domain 28
Horse(100064688) tetratricopeptide repeat domain 28
domestic cat(101091657) tetratricopeptide repeat domain 28
dog(486337) tetratricopeptide repeat domain 28
chicken(416914) tetratricopeptide repeat domain 28
naked mole-rat(101702987) tetratricopeptide repeat domain 28
domestic guinea pig(100727721) tetratricopeptide repeat domain 28
cow(537659) tetratricopeptide repeat domain 28
sheep(101119674) tetratricopeptide repeat domain 28
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145418 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145418 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145418 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024477 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024477 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024477 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001726330 Rosetta Predictions human pricing
XM_929318 Rosetta Predictions human pricing
XM_939083 Rosetta Predictions human pricing
XM_001080633 Rosetta Predictions rat pricing
XM_222260 Rosetta Predictions rat pricing
NM_024477 Rosetta Predictions mouse pricing
XM_001476544 Rosetta Predictions mouse pricing
XM_001481308 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00473632 predicted 790
2 SASI_Hs02_00473633 predicted 1547
3 SASI_Hs02_00473634 predicted 3656
4 SASI_Hs02_00473635 predicted 2149
5 SASI_Hs02_00473636 predicted 1066
6 SASI_Hs02_00473637 predicted 3289
7 SASI_Hs02_00473638 predicted 539
8 SASI_Hs02_00473639 predicted 683
9 SASI_Hs02_00473640 predicted 724
10 SASI_Hs02_00473641 predicted 2594
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929318 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00287550 predicted 3790
2 SASI_Hs01_00287551 predicted 3807
3 SASI_Hs01_00287553 predicted 6897
4 SASI_Hs01_00287555 predicted 6450
5 SASI_Hs01_00287556 predicted 4135
6 SASI_Hs01_00287557 predicted 4762
7 SASI_Hs01_00287558 predicted 4192
8 SASI_Hs02_00481042 predicted 6789
9 SASI_Hs02_00481043 predicted 6612
10 SASI_Hs01_00287559 predicted 7031
11 SASI_Hs01_00287552 predicted 6794
12 SASI_Hs01_00287554 predicted 5712
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_939083 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00483462 predicted 934
2 SASI_Hs02_00483463 predicted 1692
3 SASI_Hs02_00483464 predicted 3791
4 SASI_Hs02_00483465 predicted 2291
5 SASI_Hs02_00483466 predicted 1207
6 SASI_Hs02_00483467 predicted 3428
7 SASI_Hs02_00483468 predicted 674
8 SASI_Hs02_00483469 predicted 829
9 SASI_Hs02_00483470 predicted 864
10 SASI_Hs02_00483471 predicted 2733
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080633 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368730 predicted 1251
2 SASI_Rn02_00368731 predicted 527
3 SASI_Rn02_00368732 predicted 1248
4 SASI_Rn02_00368733 predicted 599
5 SASI_Rn02_00368734 predicted 1244
6 SASI_Rn02_00368735 predicted 1172
7 SASI_Rn02_00368736 predicted 410
8 SASI_Rn02_00368737 predicted 1244
9 SASI_Rn02_00368738 predicted 692
10 SASI_Rn02_00368739 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222260 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380705 predicted 2744
2 SASI_Rn02_00380706 predicted 2555
3 SASI_Rn02_00380707 predicted 4113
4 SASI_Rn02_00380708 predicted 2518
5 SASI_Rn02_00380709 predicted 3524
6 SASI_Rn02_00380710 predicted 557
7 SASI_Rn02_00380711 predicted 4675
8 SASI_Rn02_00380712 predicted 1313
9 SASI_Rn02_00380713 predicted 2330
10 SASI_Rn02_00380714 predicted 1933
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024477 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201577 predicted 1533
2 SASI_Mm01_00201578 predicted 2382
3 SASI_Mm01_00201579 predicted 1421
4 SASI_Mm01_00201580 predicted 659
5 SASI_Mm01_00201581 predicted 436
6 SASI_Mm01_00201582 predicted 3458
7 SASI_Mm01_00201583 predicted 2873
8 SASI_Mm01_00201584 predicted 3292
9 SASI_Mm01_00201585 predicted 2090
10 SASI_Mm01_00201586 predicted 1036
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001476544 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00389682 predicted 874
2 SASI_Mm02_00389683 predicted 3955
3 SASI_Mm02_00389684 predicted 4801
4 SASI_Mm02_00389685 predicted 2173
5 SASI_Mm02_00389686 predicted 2366
6 SASI_Mm02_00389687 predicted 746
7 SASI_Mm02_00389688 predicted 5715
8 SASI_Mm02_00389689 predicted 5303
9 SASI_Mm02_00389690 predicted 4515
10 SASI_Mm02_00389691 predicted 3457
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481308 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423596 predicted 3953
2 SASI_Mm02_00423597 predicted 2901
3 SASI_Mm02_00423598 predicted 3843
4 SASI_Mm02_00423599 predicted 3963
5 SASI_Mm02_00423600 predicted 3083
6 SASI_Mm02_00423601 predicted 2856
7 SASI_Mm02_00423602 predicted 5879
8 SASI_Mm02_00423603 predicted 5294
9 SASI_Mm02_00423604 predicted 5710
10 SASI_Mm02_00423605 predicted 4515
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145418
TTC28 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 28
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145418.1-2817s21c1
Sequence:CCGGACTATGAGGAAGCTATCAAATCTCGAGATTTGATAGCTTCCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145418.1-1729s21c1
Sequence:CCGGGTACGACCAGGCGGTCAAATACTCGAGTATTTGACCGCCTGGTCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145418.1-2292s21c1
Sequence:CCGGTAGGAAACCTGGGCGATATATCTCGAGATATATCGCCCAGGTTTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145418.1-8066s21c1
Sequence:CCGGTTCTACAGGAAAGTGTTATATCTCGAGATATAACACTTTCCTGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145418.1-892s21c1
Sequence:CCGGAGAGAAGAGCACCGGATATATCTCGAGATATATCCGGTGCTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145418
TTC28 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 28
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145418.1-2817s21c1
Sequence:CCGGACTATGAGGAAGCTATCAAATCTCGAGATTTGATAGCTTCCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145418.1-1729s21c1
Sequence:CCGGGTACGACCAGGCGGTCAAATACTCGAGTATTTGACCGCCTGGTCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145418.1-2292s21c1
Sequence:CCGGTAGGAAACCTGGGCGATATATCTCGAGATATATCGCCCAGGTTTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145418.1-8066s21c1
Sequence:CCGGTTCTACAGGAAAGTGTTATATCTCGAGATATAACACTTTCCTGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145418.1-892s21c1
Sequence:CCGGAGAGAAGAGCACCGGATATATCTCGAGATATATCCGGTGCTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145418
TTC28 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 28
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145418.1-2817s21c1
Sequence:CCGGACTATGAGGAAGCTATCAAATCTCGAGATTTGATAGCTTCCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145418.1-1729s21c1
Sequence:CCGGGTACGACCAGGCGGTCAAATACTCGAGTATTTGACCGCCTGGTCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145418.1-2292s21c1
Sequence:CCGGTAGGAAACCTGGGCGATATATCTCGAGATATATCGCCCAGGTTTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145418.1-8066s21c1
Sequence:CCGGTTCTACAGGAAAGTGTTATATCTCGAGATATAACACTTTCCTGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145418.1-892s21c1
Sequence:CCGGAGAGAAGAGCACCGGATATATCTCGAGATATATCCGGTGCTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024477
VALIDATED
TTC28 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 28
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024477.2-5191s1c1
Sequence:CCGGCCACCCACATAGCCACTGATACTCGAGTATCAGTGGCTATGTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024477.2-1531s1c1
Sequence:CCGGCGAACATTACTTGGGTGATAACTCGAGTTATCACCCAAGTAATGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024477.2-169s1c1
Sequence:CCGGCGGCAAATACACAATGGCGTTCTCGAGAACGCCATTGTGTATTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024477.2-3479s1c1
Sequence:CCGGCAAGAGGAAGTGATCCTGAAACTCGAGTTTCAGGATCACTTCCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024477.2-1532s1c1
Sequence:CCGGGAACATTACTTGGGTGATAATCTCGAGATTATCACCCAAGTAATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024477
VALIDATED
TTC28 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 28
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024477.2-5191s1c1
Sequence:CCGGCCACCCACATAGCCACTGATACTCGAGTATCAGTGGCTATGTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024477.2-1531s1c1
Sequence:CCGGCGAACATTACTTGGGTGATAACTCGAGTTATCACCCAAGTAATGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024477.2-169s1c1
Sequence:CCGGCGGCAAATACACAATGGCGTTCTCGAGAACGCCATTGTGTATTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024477.2-3479s1c1
Sequence:CCGGCAAGAGGAAGTGATCCTGAAACTCGAGTTTCAGGATCACTTCCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024477.2-1532s1c1
Sequence:CCGGGAACATTACTTGGGTGATAATCTCGAGATTATCACCCAAGTAATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024477
VALIDATED
TTC28 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 28
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024477.2-5191s1c1
Sequence:CCGGCCACCCACATAGCCACTGATACTCGAGTATCAGTGGCTATGTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024477.2-1531s1c1
Sequence:CCGGCGAACATTACTTGGGTGATAACTCGAGTTATCACCCAAGTAATGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024477.2-169s1c1
Sequence:CCGGCGGCAAATACACAATGGCGTTCTCGAGAACGCCATTGTGTATTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024477.2-3479s1c1
Sequence:CCGGCAAGAGGAAGTGATCCTGAAACTCGAGTTTCAGGATCACTTCCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024477.2-1532s1c1
Sequence:CCGGGAACATTACTTGGGTGATAATCTCGAGATTATCACCCAAGTAATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks