EMAIL THIS PAGE TO A FRIEND

TTC29

tetratricopeptide repeat domain 29

Synonyms: NYD-SP14 TBPP2A
UniProtKB ID: Q8NA56, A4GU95, Q9BXB6
Gene ID:
Mouse(73301) tetratricopeptide repeat domain 29
Rat(291944) tetratricopeptide repeat domain 29
chicken(422468) tetratricopeptide repeat domain 29
Horse(100070772) tetratricopeptide repeat domain 29
domestic cat(101095170) tetratricopeptide repeat domain 29
dog(482638) tetratricopeptide repeat domain 29
cow(536009) tetratricopeptide repeat domain 29
sheep(101108603) tetratricopeptide repeat domain 29
domestic guinea pig(100731959) tetratricopeptide repeat domain 29
naked mole-rat(101702187) tetratricopeptide repeat domain 29
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183096 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183096 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183096 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031956 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031956 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031956 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU075931 MISSION® esiRNA esiRNA human TTC29 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031956 Rosetta Predictions human pricing
NM_001013890 Rosetta Predictions rat pricing
NM_183096 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359131 predicted 342
2 SASI_Hs01_00151739 predicted 1448
3 SASI_Hs01_00151740 predicted 1171
4 SASI_Hs01_00151741 predicted 1547
5 SASI_Hs01_00151743 predicted 1370
6 SASI_Hs01_00151744 predicted 566
7 SASI_Hs01_00151745 predicted 925
8 SASI_Hs01_00151747 predicted 1452
9 SASI_Hs02_00359132 predicted 1050
10 SASI_Hs01_00151748 predicted 832
11 SASI_Hs01_00151742 predicted 1292
12 SASI_Hs01_00151746 predicted 1375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013890 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097221 predicted 1520
2 SASI_Rn01_00097222 predicted 1293
3 SASI_Rn01_00097223 predicted 1461
4 SASI_Rn01_00097225 predicted 573
5 SASI_Rn02_00201169 predicted 1583
6 SASI_Rn01_00097226 predicted 1177
7 SASI_Rn01_00097227 predicted 1044
8 SASI_Rn01_00097228 predicted 777
9 SASI_Rn01_00097229 predicted 594
10 SASI_Rn01_00097230 predicted 1401
11 SASI_Rn01_00097224 predicted 1155
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183096 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156987 predicted 1616
2 SASI_Mm01_00156988 predicted 1268
3 SASI_Mm01_00156989 predicted 789
4 SASI_Mm01_00156990 predicted 1884
5 SASI_Mm01_00156991 predicted 802
6 SASI_Mm01_00156992 predicted 815
7 SASI_Mm01_00156993 predicted 1806
8 SASI_Mm01_00156994 predicted 1378
9 SASI_Mm01_00156995 predicted 1439
10 SASI_Mm01_00156996 predicted 1504
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183096
TTC29 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 29
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183096.2-1697s1c1
Sequence:CCGGCAAATCGAGTACGACCCGATTCTCGAGAATCGGGTCGTACTCGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183096.2-732s1c1
Sequence:CCGGCGGACAAGCTAGACAATTTCTCTCGAGAGAAATTGTCTAGCTTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183096.2-485s1c1
Sequence:CCGGGCCCAGTTGATCAAAGAGAAACTCGAGTTTCTCTTTGATCAACTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190460    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183096.2-1836s1c1
Sequence:CCGGGCAGGAAGAAACTTAGCACATCTCGAGATGTGCTAAGTTTCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183096
TTC29 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 29
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183096.2-1697s1c1
Sequence:CCGGCAAATCGAGTACGACCCGATTCTCGAGAATCGGGTCGTACTCGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183096.2-732s1c1
Sequence:CCGGCGGACAAGCTAGACAATTTCTCTCGAGAGAAATTGTCTAGCTTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183096.2-485s1c1
Sequence:CCGGGCCCAGTTGATCAAAGAGAAACTCGAGTTTCTCTTTGATCAACTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190460    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183096.2-1836s1c1
Sequence:CCGGGCAGGAAGAAACTTAGCACATCTCGAGATGTGCTAAGTTTCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183096
TTC29 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 29
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183096.2-1697s1c1
Sequence:CCGGCAAATCGAGTACGACCCGATTCTCGAGAATCGGGTCGTACTCGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183096.2-732s1c1
Sequence:CCGGCGGACAAGCTAGACAATTTCTCTCGAGAGAAATTGTCTAGCTTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183096.2-485s1c1
Sequence:CCGGGCCCAGTTGATCAAAGAGAAACTCGAGTTTCTCTTTGATCAACTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190460    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183096.2-1836s1c1
Sequence:CCGGGCAGGAAGAAACTTAGCACATCTCGAGATGTGCTAAGTTTCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031956
TTC29 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 29
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000161950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031956.1-398s1c1
Sequence:CCGGGCTGCGAGATGGTTATCATAACTCGAGTTATGATAACCATCTCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031956.1-1503s1c1
Sequence:CCGGCCAGTTACTGAAGAGTTTAGACTCGAGTCTAAACTCTTCAGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031956.1-1409s1c1
Sequence:CCGGGCTTACAGTGAACAACTATATCTCGAGATATAGTTGTTCACTGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031956.1-654s1c1
Sequence:CCGGGTAAGGAACCACTTCTATGAACTCGAGTTCATAGAAGTGGTTCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031956.1-960s1c1
Sequence:CCGGGCTTCTGAAATAGCCAAAGAACTCGAGTTCTTTGGCTATTTCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031956.1-789s1c1
Sequence:CCGGGAGCATTATGAAGCATTCCATCTCGAGATGGAATGCTTCATAATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031956.1-377s1c1
Sequence:CCGGGAAGAATATCTGTGTGGACATCTCGAGATGTCCACACAGATATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031956.1-270s1c1
Sequence:CCGGCCAAGGTCTCAATTGATCAAACTCGAGTTTGATCAATTGAGACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031956.1-792s1c1
Sequence:CCGGCATTATGAAGCATTCCATCAACTCGAGTTGATGGAATGCTTCATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031956.1-618s1c1
Sequence:CCGGCTGGCCTGTTACTTCAATAATCTCGAGATTATTGAAGTAACAGGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031956.1-1406s1c1
Sequence:CCGGGATGCTTACAGTGAACAACTACTCGAGTAGTTGTTCACTGTAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031956
TTC29 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 29
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000161950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031956.1-398s1c1
Sequence:CCGGGCTGCGAGATGGTTATCATAACTCGAGTTATGATAACCATCTCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031956.1-1503s1c1
Sequence:CCGGCCAGTTACTGAAGAGTTTAGACTCGAGTCTAAACTCTTCAGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031956.1-1409s1c1
Sequence:CCGGGCTTACAGTGAACAACTATATCTCGAGATATAGTTGTTCACTGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031956.1-654s1c1
Sequence:CCGGGTAAGGAACCACTTCTATGAACTCGAGTTCATAGAAGTGGTTCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031956.1-960s1c1
Sequence:CCGGGCTTCTGAAATAGCCAAAGAACTCGAGTTCTTTGGCTATTTCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031956.1-789s1c1
Sequence:CCGGGAGCATTATGAAGCATTCCATCTCGAGATGGAATGCTTCATAATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031956.1-377s1c1
Sequence:CCGGGAAGAATATCTGTGTGGACATCTCGAGATGTCCACACAGATATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031956.1-270s1c1
Sequence:CCGGCCAAGGTCTCAATTGATCAAACTCGAGTTTGATCAATTGAGACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031956.1-792s1c1
Sequence:CCGGCATTATGAAGCATTCCATCAACTCGAGTTGATGGAATGCTTCATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031956.1-618s1c1
Sequence:CCGGCTGGCCTGTTACTTCAATAATCTCGAGATTATTGAAGTAACAGGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031956.1-1406s1c1
Sequence:CCGGGATGCTTACAGTGAACAACTACTCGAGTAGTTGTTCACTGTAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031956
TTC29 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 29
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000161950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031956.1-398s1c1
Sequence:CCGGGCTGCGAGATGGTTATCATAACTCGAGTTATGATAACCATCTCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031956.1-1503s1c1
Sequence:CCGGCCAGTTACTGAAGAGTTTAGACTCGAGTCTAAACTCTTCAGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031956.1-1409s1c1
Sequence:CCGGGCTTACAGTGAACAACTATATCTCGAGATATAGTTGTTCACTGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031956.1-654s1c1
Sequence:CCGGGTAAGGAACCACTTCTATGAACTCGAGTTCATAGAAGTGGTTCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031956.1-960s1c1
Sequence:CCGGGCTTCTGAAATAGCCAAAGAACTCGAGTTCTTTGGCTATTTCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031956.1-789s1c1
Sequence:CCGGGAGCATTATGAAGCATTCCATCTCGAGATGGAATGCTTCATAATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031956.1-377s1c1
Sequence:CCGGGAAGAATATCTGTGTGGACATCTCGAGATGTCCACACAGATATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031956.1-270s1c1
Sequence:CCGGCCAAGGTCTCAATTGATCAAACTCGAGTTTGATCAATTGAGACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031956.1-792s1c1
Sequence:CCGGCATTATGAAGCATTCCATCAACTCGAGTTGATGGAATGCTTCATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031956.1-618s1c1
Sequence:CCGGCTGGCCTGTTACTTCAATAATCTCGAGATTATTGAAGTAACAGGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031956.1-1406s1c1
Sequence:CCGGGATGCTTACAGTGAACAACTACTCGAGTAGTTGTTCACTGTAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks