EMAIL THIS PAGE TO A FRIEND

TTC30A

tetratricopeptide repeat domain 30A

UniProtKB ID: Q86WT1, A8K8N0, Q8IVP2
Gene ID:
chicken(429016) tetratricopeptide repeat domain 30A
dog(478814) tetratricopeptide repeat domain 30A
cow(510160) tetratricopeptide repeat domain 30A
sheep(101104041) tetratricopeptide repeat domain 30A
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152275 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152275 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152275 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152275 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152275 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112304 predicted 2070
2 SASI_Hs01_00112305 predicted 2065
3 SASI_Hs01_00112306 predicted 295
4 SASI_Hs01_00112307 predicted 1934
5 SASI_Hs01_00112308 predicted 1072
6 SASI_Hs01_00112309 predicted 2200
7 SASI_Hs01_00112310 predicted 2249
8 SASI_Hs01_00112311 predicted 2195
9 SASI_Hs01_00112312 predicted 2113
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152275
TTC30A MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 30A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152275.2-1931s1c1
Sequence:CCGGGCCAAAGGAAACTATGAGTTTCTCGAGAAACTCATAGTTTCCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152275.2-889s1c1
Sequence:CCGGGAAGCATATCGCTGAGATTATCTCGAGATAATCTCAGCGATATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144527    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152275.2-3245s1c1
Sequence:CCGGCGATTCTGTATAAGCCACATACTCGAGTATGTGGCTTATACAGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152275.2-2669s1c1
Sequence:CCGGCCACTTCTCAATCAGCAAATACTCGAGTATTTGCTGATTGAGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152275.2-2133s1c1
Sequence:CCGGGCACAAACATACCTGCTGTTACTCGAGTAACAGCAGGTATGTTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152275.2-755s1c1
Sequence:CCGGCTCTACAAGGAGGGACAGTATCTCGAGATACTGTCCCTCCTTGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152275.2-742s1c1
Sequence:CCGGCCTGGGTTGTTTGCTCTACAACTCGAGTTGTAGAGCAAACAACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152275.2-1376s1c1
Sequence:CCGGGCTCCTGAAGAGGCTTTCATTCTCGAGAATGAAAGCCTCTTCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152275.2-832s1c1
Sequence:CCGGCCTTTCCTACAACCTGGCTTTCTCGAGAAAGCCAGGTTGTAGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152275
TTC30A MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 30A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152275.2-1931s1c1
Sequence:CCGGGCCAAAGGAAACTATGAGTTTCTCGAGAAACTCATAGTTTCCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152275.2-889s1c1
Sequence:CCGGGAAGCATATCGCTGAGATTATCTCGAGATAATCTCAGCGATATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144527    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152275.2-3245s1c1
Sequence:CCGGCGATTCTGTATAAGCCACATACTCGAGTATGTGGCTTATACAGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152275.2-2669s1c1
Sequence:CCGGCCACTTCTCAATCAGCAAATACTCGAGTATTTGCTGATTGAGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152275.2-2133s1c1
Sequence:CCGGGCACAAACATACCTGCTGTTACTCGAGTAACAGCAGGTATGTTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152275.2-755s1c1
Sequence:CCGGCTCTACAAGGAGGGACAGTATCTCGAGATACTGTCCCTCCTTGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152275.2-742s1c1
Sequence:CCGGCCTGGGTTGTTTGCTCTACAACTCGAGTTGTAGAGCAAACAACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152275.2-1376s1c1
Sequence:CCGGGCTCCTGAAGAGGCTTTCATTCTCGAGAATGAAAGCCTCTTCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152275.2-832s1c1
Sequence:CCGGCCTTTCCTACAACCTGGCTTTCTCGAGAAAGCCAGGTTGTAGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152275
TTC30A MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 30A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152275.2-1931s1c1
Sequence:CCGGGCCAAAGGAAACTATGAGTTTCTCGAGAAACTCATAGTTTCCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152275.2-889s1c1
Sequence:CCGGGAAGCATATCGCTGAGATTATCTCGAGATAATCTCAGCGATATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144527    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152275.2-3245s1c1
Sequence:CCGGCGATTCTGTATAAGCCACATACTCGAGTATGTGGCTTATACAGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152275.2-2669s1c1
Sequence:CCGGCCACTTCTCAATCAGCAAATACTCGAGTATTTGCTGATTGAGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152275.2-2133s1c1
Sequence:CCGGGCACAAACATACCTGCTGTTACTCGAGTAACAGCAGGTATGTTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152275.2-755s1c1
Sequence:CCGGCTCTACAAGGAGGGACAGTATCTCGAGATACTGTCCCTCCTTGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152275.2-742s1c1
Sequence:CCGGCCTGGGTTGTTTGCTCTACAACTCGAGTTGTAGAGCAAACAACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152275.2-1376s1c1
Sequence:CCGGGCTCCTGAAGAGGCTTTCATTCTCGAGAATGAAAGCCTCTTCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152275.2-832s1c1
Sequence:CCGGCCTTTCCTACAACCTGGCTTTCTCGAGAAAGCCAGGTTGTAGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks