EMAIL THIS PAGE TO A FRIEND

TTC30B

tetratricopeptide repeat domain 30B

Synonyms: IFT70 fleer
UniProtKB ID: Q8N4P2, Q63HQ1, Q96NE6
Gene ID:
Mouse(72421) tetratricopeptide repeat domain 30B
Rat(499814) tetratricopeptide repeat domain 30B
cow(538713) tetratricopeptide repeat domain 30B
sheep(101104297) tetratricopeptide repeat domain 30B
domestic guinea pig(100721103) tetratricopeptide repeat domain 30B
naked mole-rat(101699979) tetratricopeptide repeat domain 30B
dog(610209) tetratricopeptide repeat domain 30B
Horse(100067029) tetratricopeptide repeat domain 30B
Horse(100146529) tetratricopeptide repeat domain 30B
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152517 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152517 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152517 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028235 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028235 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028235 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152517 Rosetta Predictions human pricing
NM_001127607 Rosetta Predictions rat pricing
XR_005475 Rosetta Predictions rat pricing
NM_028235 Rosetta Predictions mouse pricing
XM_001003944 Rosetta Predictions mouse pricing
XM_485010 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152517 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227895 predicted 1695
2 SASI_Hs01_00227900 predicted 1621
3 SASI_Hs01_00227897 predicted 1203
4 SASI_Hs01_00227898 predicted 1880
5 SASI_Hs01_00227899 predicted 1889
6 SASI_Hs01_00227902 predicted 63
7 SASI_Hs01_00227903 predicted 2010
8 SASI_Hs02_00366304 predicted 2028
9 SASI_Hs02_00366305 predicted 2098
10 SASI_Hs02_00366306 predicted 2045
11 SASI_Hs01_00227894 predicted 272
12 SASI_Hs01_00227896 predicted 279
13 SASI_Hs01_00227901 predicted 1604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127607 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254650 predicted 339
2 SASI_Rn02_00254651 predicted 600
3 SASI_Rn02_00254652 predicted 643
4 SASI_Rn02_00254653 predicted 1868
5 SASI_Rn02_00254654 predicted 579
6 SASI_Rn02_00254655 predicted 1247
7 SASI_Rn02_00254656 predicted 588
8 SASI_Rn02_00254657 predicted 2020
9 SASI_Rn02_00254658 predicted 713
10 SASI_Rn02_00254659 predicted 635
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005475 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00178421 predicted 31
2 SASI_Rn01_00178422 predicted 2028
3 SASI_Rn01_00178423 predicted 979
4 SASI_Rn01_00178424 predicted 32
5 SASI_Rn01_00178425 predicted 874
6 SASI_Rn01_00178426 predicted 103
7 SASI_Rn01_00178427 predicted 1391
8 SASI_Rn01_00178428 predicted 1358
9 SASI_Rn01_00178429 predicted 12
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028235 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333578 predicted 2131
2 SASI_Mm02_00333579 predicted 2116
3 SASI_Mm02_00333580 predicted 2044
4 SASI_Mm02_00333581 predicted 2138
5 SASI_Mm02_00333582 predicted 1232
6 SASI_Mm02_00333583 predicted 1914
7 SASI_Mm02_00333584 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003944 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205216 predicted 2180
2 SASI_Mm01_00205217 predicted 2164
3 SASI_Mm01_00205218 predicted 2083
4 SASI_Mm01_00205219 predicted 2189
5 SASI_Mm01_00205220 predicted 1272
6 SASI_Mm01_00205221 predicted 1963
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485010 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00243541 predicted 2252
2 SASI_Mm01_00243542 predicted 2246
3 SASI_Mm01_00243543 predicted 2167
4 SASI_Mm01_00243544 predicted 2270
5 SASI_Mm01_00243545 predicted 1353
6 SASI_Mm01_00243546 predicted 2048
7 SASI_Mm01_00243547 predicted 650
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152517
TTC30B MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 30B
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152517.2-1833s21c1
Sequence:CCGGCACAATCATGCTTCGTGATAGCTCGAGCTATCACGAAGCATGATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152517.2-2420s21c1
Sequence:CCGGGAGAGTAGTCTCACAATTTACCTCGAGGTAAATTGTGAGACTACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152517.2-2188s21c1
Sequence:CCGGCAGAAAGTGACATATTCTAAGCTCGAGCTTAGAATATGTCACTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152517.2-730s21c1
Sequence:CCGGGGCATTGATGTTCGCAGTGTTCTCGAGAACACTGCGAACATCAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152517.1-1297s1c1
Sequence:CCGGCGACCATGATGTGTGGAAGTTCTCGAGAACTTCCACACATCATGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152517.1-490s1c1
Sequence:CCGGCCTGGGTTGTTTGCTCTACAACTCGAGTTGTAGAGCAAACAACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152517.1-1043s1c1
Sequence:CCGGGCTCCTGAAGAGGCTTTCATTCTCGAGAATGAAAGCCTCTTCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152517.1-1102s1c1
Sequence:CCGGCCGGAAACTTACCATACAAGTCTCGAGACTTGTATGGTAAGTTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152517.1-1800s1c1
Sequence:CCGGGCAGAAACATACCTGCTGTTACTCGAGTAACAGCAGGTATGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152517.1-1872s1c1
Sequence:CCGGCATATGAGTCTAGGCAGTTAACTCGAGTTAACTGCCTAGACTCATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152517.1-1103s1c1
Sequence:CCGGCGGAAACTTACCATACAAGTACTCGAGTACTTGTATGGTAAGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154641    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152517.1-1982s1c1
Sequence:CCGGCGCTTTATTTACCCTTTGGCACTCGAGTGCCAAAGGGTAAATAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152517
TTC30B MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 30B
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152517.2-1833s21c1
Sequence:CCGGCACAATCATGCTTCGTGATAGCTCGAGCTATCACGAAGCATGATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152517.2-2420s21c1
Sequence:CCGGGAGAGTAGTCTCACAATTTACCTCGAGGTAAATTGTGAGACTACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152517.2-2188s21c1
Sequence:CCGGCAGAAAGTGACATATTCTAAGCTCGAGCTTAGAATATGTCACTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152517.2-730s21c1
Sequence:CCGGGGCATTGATGTTCGCAGTGTTCTCGAGAACACTGCGAACATCAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152517.1-1297s1c1
Sequence:CCGGCGACCATGATGTGTGGAAGTTCTCGAGAACTTCCACACATCATGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152517.1-490s1c1
Sequence:CCGGCCTGGGTTGTTTGCTCTACAACTCGAGTTGTAGAGCAAACAACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152517.1-1043s1c1
Sequence:CCGGGCTCCTGAAGAGGCTTTCATTCTCGAGAATGAAAGCCTCTTCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152517.1-1102s1c1
Sequence:CCGGCCGGAAACTTACCATACAAGTCTCGAGACTTGTATGGTAAGTTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152517.1-1800s1c1
Sequence:CCGGGCAGAAACATACCTGCTGTTACTCGAGTAACAGCAGGTATGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152517.1-1872s1c1
Sequence:CCGGCATATGAGTCTAGGCAGTTAACTCGAGTTAACTGCCTAGACTCATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152517.1-1103s1c1
Sequence:CCGGCGGAAACTTACCATACAAGTACTCGAGTACTTGTATGGTAAGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154641    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152517.1-1982s1c1
Sequence:CCGGCGCTTTATTTACCCTTTGGCACTCGAGTGCCAAAGGGTAAATAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152517
TTC30B MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 30B
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152517.2-1833s21c1
Sequence:CCGGCACAATCATGCTTCGTGATAGCTCGAGCTATCACGAAGCATGATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152517.2-2420s21c1
Sequence:CCGGGAGAGTAGTCTCACAATTTACCTCGAGGTAAATTGTGAGACTACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152517.2-2188s21c1
Sequence:CCGGCAGAAAGTGACATATTCTAAGCTCGAGCTTAGAATATGTCACTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152517.2-730s21c1
Sequence:CCGGGGCATTGATGTTCGCAGTGTTCTCGAGAACACTGCGAACATCAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152517.1-1297s1c1
Sequence:CCGGCGACCATGATGTGTGGAAGTTCTCGAGAACTTCCACACATCATGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152517.1-490s1c1
Sequence:CCGGCCTGGGTTGTTTGCTCTACAACTCGAGTTGTAGAGCAAACAACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152517.1-1043s1c1
Sequence:CCGGGCTCCTGAAGAGGCTTTCATTCTCGAGAATGAAAGCCTCTTCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152517.1-1102s1c1
Sequence:CCGGCCGGAAACTTACCATACAAGTCTCGAGACTTGTATGGTAAGTTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152517.1-1800s1c1
Sequence:CCGGGCAGAAACATACCTGCTGTTACTCGAGTAACAGCAGGTATGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152517.1-1872s1c1
Sequence:CCGGCATATGAGTCTAGGCAGTTAACTCGAGTTAACTGCCTAGACTCATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152517.1-1103s1c1
Sequence:CCGGCGGAAACTTACCATACAAGTACTCGAGTACTTGTATGGTAAGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154641    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152517.1-1982s1c1
Sequence:CCGGCGCTTTATTTACCCTTTGGCACTCGAGTGCCAAAGGGTAAATAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028235
TTC30B MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 30B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028235.1-2045s21c1
Sequence:CCGGGTGTAATTACCGCTGACAATTCTCGAGAATTGTCAGCGGTAATTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028235.1-1923s21c1
Sequence:CCGGGAAACATTCCAGCTGTTATAGCTCGAGCTATAACAGCTGGAATGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028235.1-2320s21c1
Sequence:CCGGTTGGACAACCTTTGCTATTATCTCGAGATAATAGCAAAGGTTGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028235.1-2007s21c1
Sequence:CCGGAGTTGAGGGCTCTGATTTATGCTCGAGCATAAATCAGAGCCCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028235.1-1220s21c1
Sequence:CCGGCTCCGGAAACTCACCATACAACTCGAGTTGTATGGTGAGTTTCCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028235
TTC30B MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 30B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028235.1-2045s21c1
Sequence:CCGGGTGTAATTACCGCTGACAATTCTCGAGAATTGTCAGCGGTAATTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028235.1-1923s21c1
Sequence:CCGGGAAACATTCCAGCTGTTATAGCTCGAGCTATAACAGCTGGAATGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028235.1-2320s21c1
Sequence:CCGGTTGGACAACCTTTGCTATTATCTCGAGATAATAGCAAAGGTTGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028235.1-2007s21c1
Sequence:CCGGAGTTGAGGGCTCTGATTTATGCTCGAGCATAAATCAGAGCCCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028235.1-1220s21c1
Sequence:CCGGCTCCGGAAACTCACCATACAACTCGAGTTGTATGGTGAGTTTCCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028235
TTC30B MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 30B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028235.1-2045s21c1
Sequence:CCGGGTGTAATTACCGCTGACAATTCTCGAGAATTGTCAGCGGTAATTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028235.1-1923s21c1
Sequence:CCGGGAAACATTCCAGCTGTTATAGCTCGAGCTATAACAGCTGGAATGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028235.1-2320s21c1
Sequence:CCGGTTGGACAACCTTTGCTATTATCTCGAGATAATAGCAAAGGTTGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028235.1-2007s21c1
Sequence:CCGGAGTTGAGGGCTCTGATTTATGCTCGAGCATAAATCAGAGCCCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028235.1-1220s21c1
Sequence:CCGGCTCCGGAAACTCACCATACAACTCGAGTTGTATGGTGAGTTTCCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks