EMAIL THIS PAGE TO A FRIEND

TTC31

tetratricopeptide repeat domain 31

UniProtKB ID: Q49AM3, Q4KN40, Q53FD4, Q9H9F7
Gene ID:
dog(475786) tetratricopeptide repeat domain 31
Horse(100053836) tetratricopeptide repeat domain 31
domestic cat(101086716) tetratricopeptide repeat domain 31
naked mole-rat(101699310) tetratricopeptide repeat domain 31
domestic guinea pig(100736111) tetratricopeptide repeat domain 31
cow(789027) tetratricopeptide repeat domain 31
sheep(101107183) tetratricopeptide repeat domain 31
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022492 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022492 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022492 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022492 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022492 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355799 predicted 1652
2 SASI_Hs02_00355800 predicted 1616
3 SASI_Hs01_00031588 predicted 508
4 SASI_Hs02_00355801 predicted 1413
5 SASI_Hs02_00355802 predicted 1015
6 SASI_Hs01_00031593 predicted 535
7 SASI_Hs01_00031594 predicted 1181
8 SASI_Hs02_00355803 predicted 267
9 SASI_Hs02_00355804 predicted 1660
10 SASI_Hs02_00355805 predicted 1690
11 SASI_Hs01_00031589 predicted 1095
12 SASI_Hs01_00031590 predicted 1319
13 SASI_Hs01_00031591 predicted 1089
14 SASI_Hs01_00031592 predicted 1098
15 SASI_Hs01_00031595 predicted 1268
16 SASI_Hs01_00031596 predicted 1266
17 SASI_Hs01_00031597 predicted 1442
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022492
VALIDATED
TTC31 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 31
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022492.1-685s1c1
Sequence:CCGGGAAGAAGAGGACTCACTGGATCTCGAGATCCAGTGAGTCCTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022492.1-688s1c1
Sequence:CCGGGAAGAGGACTCACTGGATCTACTCGAGTAGATCCAGTGAGTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022492.1-132s1c1
Sequence:CCGGCGAAGAGGACATAGTGGATTTCTCGAGAAATCCACTATGTCCTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022492.1-516s1c1
Sequence:CCGGCATGAAACAGAAAGCAGAGAACTCGAGTTCTCTGCTTTCTGTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022492.1-92s1c1
Sequence:CCGGCACCCAAACTTTGCAAGGAATCTCGAGATTCCTTGCAAAGTTTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022492.1-511s1c1
Sequence:CCGGGAGCGCATGAAACAGAAAGCACTCGAGTGCTTTCTGTTTCATGCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022492.1-124s1c1
Sequence:CCGGGATTACGGCGAAGAGGACATACTCGAGTATGTCCTCTTCGCCGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022492.3-90s21c1
Sequence:CCGGCACCCAAACTTTGCAAGGAATCTCGAGATTCCTTGCAAAGTTTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022492.3-686s21c1
Sequence:CCGGGAAGAGGACTCACTGGATCTACTCGAGTAGATCCAGTGAGTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022492.3-130s21c1
Sequence:CCGGCGAAGAGGACATAGTGGATTTCTCGAGAAATCCACTATGTCCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022492.3-509s21c1
Sequence:CCGGGAGCGCATGAAACAGAAAGCACTCGAGTGCTTTCTGTTTCATGCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022492
VALIDATED
TTC31 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 31
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022492.1-685s1c1
Sequence:CCGGGAAGAAGAGGACTCACTGGATCTCGAGATCCAGTGAGTCCTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022492.1-688s1c1
Sequence:CCGGGAAGAGGACTCACTGGATCTACTCGAGTAGATCCAGTGAGTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022492.1-132s1c1
Sequence:CCGGCGAAGAGGACATAGTGGATTTCTCGAGAAATCCACTATGTCCTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022492.1-516s1c1
Sequence:CCGGCATGAAACAGAAAGCAGAGAACTCGAGTTCTCTGCTTTCTGTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022492.1-92s1c1
Sequence:CCGGCACCCAAACTTTGCAAGGAATCTCGAGATTCCTTGCAAAGTTTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022492.1-511s1c1
Sequence:CCGGGAGCGCATGAAACAGAAAGCACTCGAGTGCTTTCTGTTTCATGCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022492.1-124s1c1
Sequence:CCGGGATTACGGCGAAGAGGACATACTCGAGTATGTCCTCTTCGCCGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022492.3-90s21c1
Sequence:CCGGCACCCAAACTTTGCAAGGAATCTCGAGATTCCTTGCAAAGTTTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022492.3-686s21c1
Sequence:CCGGGAAGAGGACTCACTGGATCTACTCGAGTAGATCCAGTGAGTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022492.3-130s21c1
Sequence:CCGGCGAAGAGGACATAGTGGATTTCTCGAGAAATCCACTATGTCCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022492.3-509s21c1
Sequence:CCGGGAGCGCATGAAACAGAAAGCACTCGAGTGCTTTCTGTTTCATGCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022492
VALIDATED
TTC31 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 31
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022492.1-685s1c1
Sequence:CCGGGAAGAAGAGGACTCACTGGATCTCGAGATCCAGTGAGTCCTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022492.1-688s1c1
Sequence:CCGGGAAGAGGACTCACTGGATCTACTCGAGTAGATCCAGTGAGTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022492.1-132s1c1
Sequence:CCGGCGAAGAGGACATAGTGGATTTCTCGAGAAATCCACTATGTCCTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022492.1-516s1c1
Sequence:CCGGCATGAAACAGAAAGCAGAGAACTCGAGTTCTCTGCTTTCTGTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022492.1-92s1c1
Sequence:CCGGCACCCAAACTTTGCAAGGAATCTCGAGATTCCTTGCAAAGTTTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022492.1-511s1c1
Sequence:CCGGGAGCGCATGAAACAGAAAGCACTCGAGTGCTTTCTGTTTCATGCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022492.1-124s1c1
Sequence:CCGGGATTACGGCGAAGAGGACATACTCGAGTATGTCCTCTTCGCCGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022492.3-90s21c1
Sequence:CCGGCACCCAAACTTTGCAAGGAATCTCGAGATTCCTTGCAAAGTTTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022492.3-686s21c1
Sequence:CCGGGAAGAGGACTCACTGGATCTACTCGAGTAGATCCAGTGAGTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022492.3-130s21c1
Sequence:CCGGCGAAGAGGACATAGTGGATTTCTCGAGAAATCCACTATGTCCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022492.3-509s21c1
Sequence:CCGGGAGCGCATGAAACAGAAAGCACTCGAGTGCTTTCTGTTTCATGCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks