EMAIL THIS PAGE TO A FRIEND

TTC32

tetratricopeptide repeat domain 32

UniProtKB ID: Q5I0X7
Gene ID:
Mouse(75516) tetratricopeptide repeat domain 32
Rat(684830) tetratricopeptide repeat domain 32
cow(525750) tetratricopeptide repeat domain 32
sheep(101102886) tetratricopeptide repeat domain 32
domestic guinea pig(100723195) tetratricopeptide repeat domain 32
naked mole-rat(101722831) tetratricopeptide repeat domain 32
Zebrafish(100004012) tetratricopeptide repeat domain 32
chicken(769943) tetratricopeptide repeat domain 32
Horse(100056502) tetratricopeptide repeat domain 32
domestic cat(101083582) tetratricopeptide repeat domain 32
dog(610581) tetratricopeptide repeat domain 32
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008237 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008237 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008237 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029321 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029321 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029321 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041801 MISSION® esiRNA esiRNA human TTC32 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008237 Rosetta Predictions human pricing
XM_001072100 Rosetta Predictions rat pricing
NM_029321 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008237 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087070 predicted 509
2 SASI_Hs01_00087071 predicted 374
3 SASI_Hs01_00087072 predicted 209
4 SASI_Hs01_00087073 predicted 476
5 SASI_Hs01_00087074 predicted 272
6 SASI_Hs01_00087075 predicted 290
7 SASI_Hs01_00087076 predicted 365
8 SASI_Hs01_00087077 predicted 435
9 SASI_Hs01_00087078 predicted 264
10 SASI_Hs01_00087079 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072100 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337813 predicted 292
2 SASI_Rn02_00337814 predicted 218
3 SASI_Rn02_00337815 predicted 294
4 SASI_Rn02_00337816 predicted 251
5 SASI_Rn02_00337817 predicted 216
6 SASI_Rn02_00337818 predicted 411
7 SASI_Rn02_00337819 predicted 221
8 SASI_Rn02_00337820 predicted 290
9 SASI_Rn02_00337821 predicted 291
10 SASI_Rn02_00337822 predicted 214
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029321 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124892 predicted 282
2 SASI_Mm01_00124893 predicted 281
3 SASI_Mm01_00124894 predicted 410
4 SASI_Mm01_00124895 predicted 247
5 SASI_Mm01_00124896 predicted 210
6 SASI_Mm01_00124897 predicted 315
7 SASI_Mm02_00335136 predicted 194
8 SASI_Mm01_00124899 predicted 531
9 SASI_Mm01_00124900 predicted 395
10 SASI_Mm01_00124901 predicted 543
11 SASI_Mm01_00124898 predicted 211
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008237
VALIDATED
TTC32 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 32
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008237.1-296s21c1
Sequence:CCGGAGGATTTGGCTACTGCATATACTCGAGTATATGCAGTAGCCAAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008237.1-416s21c1
Sequence:CCGGATTACAACAGAGGGTTGATACCTCGAGGTATCAACCCTCTGTTGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008237.1-607s21c1
Sequence:CCGGAGTATTGATTCATGGTCCTTACTCGAGTAAGGACCATGAATCAATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008237.1-477s21c1
Sequence:CCGGCAAGAAGGTCTTAGACTTAAACTCGAGTTTAAGTCTAAGACCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008237.1-178s1c1
Sequence:CCGGCAGGCTCATTTCAACAATGGACTCGAGTCCATTGTTGAAATGAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001008237.1-623s1c1
Sequence:CCGGCCTTACATCTGCATCTAGTTACTCGAGTAACTAGATGCAGATGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001008237.1-367s1c1
Sequence:CCGGGATGACTACACATCTGCCATACTCGAGTATGGCAGATGTGTAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008237.1-328s1c1
Sequence:CCGGCAAATCAAGTACTTCAGGGTTCTCGAGAACCCTGAAGTACTTGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001008237.1-432s1c1
Sequence:CCGGGATACTGTATAGGCTGGGATACTCGAGTATCCCAGCCTATACAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001008237.1-370s1c1
Sequence:CCGGGACTACACATCTGCCATAGAACTCGAGTTCTATGGCAGATGTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001008237.1-383s1c1
Sequence:CCGGCCATAGAAGTCCAACCCAATTCTCGAGAATTGGGTTGGACTTCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001008237.1-175s1c1
Sequence:CCGGGCCCAGGCTCATTTCAACAATCTCGAGATTGTTGAAATGAGCCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001008237.1-361s1c1
Sequence:CCGGGCCATGGATGACTACACATCTCTCGAGAGATGTGTAGTCATCCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008237
VALIDATED
TTC32 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 32
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008237.1-296s21c1
Sequence:CCGGAGGATTTGGCTACTGCATATACTCGAGTATATGCAGTAGCCAAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008237.1-416s21c1
Sequence:CCGGATTACAACAGAGGGTTGATACCTCGAGGTATCAACCCTCTGTTGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008237.1-607s21c1
Sequence:CCGGAGTATTGATTCATGGTCCTTACTCGAGTAAGGACCATGAATCAATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008237.1-477s21c1
Sequence:CCGGCAAGAAGGTCTTAGACTTAAACTCGAGTTTAAGTCTAAGACCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008237.1-178s1c1
Sequence:CCGGCAGGCTCATTTCAACAATGGACTCGAGTCCATTGTTGAAATGAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001008237.1-623s1c1
Sequence:CCGGCCTTACATCTGCATCTAGTTACTCGAGTAACTAGATGCAGATGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001008237.1-367s1c1
Sequence:CCGGGATGACTACACATCTGCCATACTCGAGTATGGCAGATGTGTAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008237.1-328s1c1
Sequence:CCGGCAAATCAAGTACTTCAGGGTTCTCGAGAACCCTGAAGTACTTGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001008237.1-432s1c1
Sequence:CCGGGATACTGTATAGGCTGGGATACTCGAGTATCCCAGCCTATACAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001008237.1-370s1c1
Sequence:CCGGGACTACACATCTGCCATAGAACTCGAGTTCTATGGCAGATGTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001008237.1-383s1c1
Sequence:CCGGCCATAGAAGTCCAACCCAATTCTCGAGAATTGGGTTGGACTTCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001008237.1-175s1c1
Sequence:CCGGGCCCAGGCTCATTTCAACAATCTCGAGATTGTTGAAATGAGCCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001008237.1-361s1c1
Sequence:CCGGGCCATGGATGACTACACATCTCTCGAGAGATGTGTAGTCATCCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008237
VALIDATED
TTC32 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 32
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008237.1-296s21c1
Sequence:CCGGAGGATTTGGCTACTGCATATACTCGAGTATATGCAGTAGCCAAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008237.1-416s21c1
Sequence:CCGGATTACAACAGAGGGTTGATACCTCGAGGTATCAACCCTCTGTTGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008237.1-607s21c1
Sequence:CCGGAGTATTGATTCATGGTCCTTACTCGAGTAAGGACCATGAATCAATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008237.1-477s21c1
Sequence:CCGGCAAGAAGGTCTTAGACTTAAACTCGAGTTTAAGTCTAAGACCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008237.1-178s1c1
Sequence:CCGGCAGGCTCATTTCAACAATGGACTCGAGTCCATTGTTGAAATGAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001008237.1-623s1c1
Sequence:CCGGCCTTACATCTGCATCTAGTTACTCGAGTAACTAGATGCAGATGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001008237.1-367s1c1
Sequence:CCGGGATGACTACACATCTGCCATACTCGAGTATGGCAGATGTGTAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008237.1-328s1c1
Sequence:CCGGCAAATCAAGTACTTCAGGGTTCTCGAGAACCCTGAAGTACTTGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001008237.1-432s1c1
Sequence:CCGGGATACTGTATAGGCTGGGATACTCGAGTATCCCAGCCTATACAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001008237.1-370s1c1
Sequence:CCGGGACTACACATCTGCCATAGAACTCGAGTTCTATGGCAGATGTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001008237.1-383s1c1
Sequence:CCGGCCATAGAAGTCCAACCCAATTCTCGAGAATTGGGTTGGACTTCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001008237.1-175s1c1
Sequence:CCGGGCCCAGGCTCATTTCAACAATCTCGAGATTGTTGAAATGAGCCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001008237.1-361s1c1
Sequence:CCGGGCCATGGATGACTACACATCTCTCGAGAGATGTGTAGTCATCCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029321
VALIDATED
TTC32 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 32
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029321.1-697s1c1
Sequence:CCGGCCAGTGTATAAATGTATGCTACTCGAGTAGCATACATTTATACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029321.1-200s1c1
Sequence:CCGGGCAAATGTAGCCCTGAGGATTCTCGAGAATCCTCAGGGCTACATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029321.1-477s1c1
Sequence:CCGGGCAAAGACGAAATGCCGAGAACTCGAGTTCTCGGCATTTCGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029321.1-317s1c1
Sequence:CCGGCCAGCTTTGAAGTTCCCTATTCTCGAGAATAGGGAACTTCAAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029321.1-418s1c1
Sequence:CCGGCCTGGATTTCAAGATGCTGTTCTCGAGAACAGCATCTTGAAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029321
VALIDATED
TTC32 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 32
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029321.1-697s1c1
Sequence:CCGGCCAGTGTATAAATGTATGCTACTCGAGTAGCATACATTTATACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029321.1-200s1c1
Sequence:CCGGGCAAATGTAGCCCTGAGGATTCTCGAGAATCCTCAGGGCTACATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029321.1-477s1c1
Sequence:CCGGGCAAAGACGAAATGCCGAGAACTCGAGTTCTCGGCATTTCGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029321.1-317s1c1
Sequence:CCGGCCAGCTTTGAAGTTCCCTATTCTCGAGAATAGGGAACTTCAAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029321.1-418s1c1
Sequence:CCGGCCTGGATTTCAAGATGCTGTTCTCGAGAACAGCATCTTGAAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029321
VALIDATED
TTC32 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 32
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029321.1-697s1c1
Sequence:CCGGCCAGTGTATAAATGTATGCTACTCGAGTAGCATACATTTATACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029321.1-200s1c1
Sequence:CCGGGCAAATGTAGCCCTGAGGATTCTCGAGAATCCTCAGGGCTACATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029321.1-477s1c1
Sequence:CCGGGCAAAGACGAAATGCCGAGAACTCGAGTTCTCGGCATTTCGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029321.1-317s1c1
Sequence:CCGGCCAGCTTTGAAGTTCCCTATTCTCGAGAATAGGGAACTTCAAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029321.1-418s1c1
Sequence:CCGGCCTGGATTTCAAGATGCTGTTCTCGAGAACAGCATCTTGAAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks