EMAIL THIS PAGE TO A FRIEND

TTC33

tetratricopeptide repeat domain 33

Synonyms: OSRF
UniProtKB ID: Q6PID6, B2R6G0, O95105
Gene ID:
Mouse(67515) tetratricopeptide repeat domain 33
Rat(294774) tetratricopeptide repeat domain 33
Zebrafish(436995) tetratricopeptide repeat domain 33
chicken(427184) tetratricopeptide repeat domain 33
dog(479352) tetratricopeptide repeat domain 33
domestic cat(101096287) tetratricopeptide repeat domain 33
naked mole-rat(101723348) tetratricopeptide repeat domain 33
domestic guinea pig(100734536) tetratricopeptide repeat domain 33
cow(531278) tetratricopeptide repeat domain 33
sheep(101104092) tetratricopeptide repeat domain 33
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012382 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012382 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012382 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026213 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026213 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026213 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118471 MISSION® esiRNA esiRNA human TTC33 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012382 Rosetta Predictions human pricing
NM_001106414 Rosetta Predictions rat pricing
NM_026213 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012382 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084699 predicted 678
2 SASI_Hs01_00084700 predicted 367
3 SASI_Hs01_00084701 predicted 613
4 SASI_Hs01_00084702 predicted 922
5 SASI_Hs02_00344178 predicted 535
6 SASI_Hs01_00084703 predicted 857
7 SASI_Hs01_00084704 predicted 396
8 SASI_Hs01_00084705 predicted 566
9 SASI_Hs01_00084707 predicted 557
10 SASI_Hs01_00084708 predicted 390
11 SASI_Hs01_00084706 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106414 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218728 predicted 1329
2 SASI_Rn02_00218729 predicted 1300
3 SASI_Rn02_00218730 predicted 1272
4 SASI_Rn02_00218731 predicted 607
5 SASI_Rn02_00218732 predicted 1234
6 SASI_Rn02_00218733 predicted 1260
7 SASI_Rn02_00218734 predicted 531
8 SASI_Rn02_00218735 predicted 685
9 SASI_Rn02_00218736 predicted 657
10 SASI_Rn02_00218737 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026213 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021489 predicted 741
2 SASI_Mm02_00329880 predicted 1236
3 SASI_Mm01_00021492 predicted 643
4 SASI_Mm01_00021493 predicted 705
5 SASI_Mm01_00021494 predicted 725
6 SASI_Mm01_00021495 predicted 637
7 SASI_Mm01_00021496 predicted 1337
8 SASI_Mm01_00021497 predicted 639
9 SASI_Mm01_00021498 predicted 421
10 SASI_Mm02_00329881 predicted 455
11 SASI_Mm01_00021490 predicted 563
12 SASI_Mm01_00021491 predicted 1311
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012382
VALIDATED
TTC33 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 33
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000160409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012382.1-1744s1c1
Sequence:CCGGCCTGGAAACAACTTACTTCTTCTCGAGAAGAAGTAAGTTGTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012382.1-185s1c1
Sequence:CCGGGATGTAGTTGACAACGATGAACTCGAGTTCATCGTTGTCAACTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012382.1-222s1c1
Sequence:CCGGCCATTAAACGTAGGAAAGAAACTCGAGTTTCTTTCCTACGTTTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012382.1-1289s1c1
Sequence:CCGGCGCTTAATATTTGCTGTCTTTCTCGAGAAAGACAGCAAATATTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012382.1-783s1c1
Sequence:CCGGCAATGGTTATTGTGTCTGCTTCTCGAGAAGCAGACACAATAACCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012382.1-1288s1c1
Sequence:CCGGGCGCTTAATATTTGCTGTCTTCTCGAGAAGACAGCAAATATTAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012382.1-717s1c1
Sequence:CCGGGTGATGAGATTGTTGCTGTTTCTCGAGAAACAGCAACAATCTCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012382.2-440s21c1
Sequence:CCGGATGAAATCACAGGTGCTAATGCTCGAGCATTAGCACCTGTGATTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012382.2-616s21c1
Sequence:CCGGCTATCCAATGAACCCTGAAATCTCGAGATTTCAGGGTTCATTGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012382.2-1081s21c1
Sequence:CCGGGCAGGATTATTGTATAGTGTTCTCGAGAACACTATACAATAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012382.2-415s21c1
Sequence:CCGGTCCAAATGATGCTACCCTATACTCGAGTATAGGGTAGCATCATTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012382.2-393s21c1
Sequence:CCGGGGGATGAAGCACTACAGTTAACTCGAGTTAACTGTAGTGCTTCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012382
VALIDATED
TTC33 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 33
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000160409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012382.1-1744s1c1
Sequence:CCGGCCTGGAAACAACTTACTTCTTCTCGAGAAGAAGTAAGTTGTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012382.1-185s1c1
Sequence:CCGGGATGTAGTTGACAACGATGAACTCGAGTTCATCGTTGTCAACTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012382.1-222s1c1
Sequence:CCGGCCATTAAACGTAGGAAAGAAACTCGAGTTTCTTTCCTACGTTTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012382.1-1289s1c1
Sequence:CCGGCGCTTAATATTTGCTGTCTTTCTCGAGAAAGACAGCAAATATTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012382.1-783s1c1
Sequence:CCGGCAATGGTTATTGTGTCTGCTTCTCGAGAAGCAGACACAATAACCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012382.1-1288s1c1
Sequence:CCGGGCGCTTAATATTTGCTGTCTTCTCGAGAAGACAGCAAATATTAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012382.1-717s1c1
Sequence:CCGGGTGATGAGATTGTTGCTGTTTCTCGAGAAACAGCAACAATCTCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012382.2-440s21c1
Sequence:CCGGATGAAATCACAGGTGCTAATGCTCGAGCATTAGCACCTGTGATTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012382.2-616s21c1
Sequence:CCGGCTATCCAATGAACCCTGAAATCTCGAGATTTCAGGGTTCATTGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012382.2-1081s21c1
Sequence:CCGGGCAGGATTATTGTATAGTGTTCTCGAGAACACTATACAATAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012382.2-415s21c1
Sequence:CCGGTCCAAATGATGCTACCCTATACTCGAGTATAGGGTAGCATCATTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012382.2-393s21c1
Sequence:CCGGGGGATGAAGCACTACAGTTAACTCGAGTTAACTGTAGTGCTTCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012382
VALIDATED
TTC33 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 33
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000160409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012382.1-1744s1c1
Sequence:CCGGCCTGGAAACAACTTACTTCTTCTCGAGAAGAAGTAAGTTGTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012382.1-185s1c1
Sequence:CCGGGATGTAGTTGACAACGATGAACTCGAGTTCATCGTTGTCAACTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012382.1-222s1c1
Sequence:CCGGCCATTAAACGTAGGAAAGAAACTCGAGTTTCTTTCCTACGTTTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012382.1-1289s1c1
Sequence:CCGGCGCTTAATATTTGCTGTCTTTCTCGAGAAAGACAGCAAATATTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012382.1-783s1c1
Sequence:CCGGCAATGGTTATTGTGTCTGCTTCTCGAGAAGCAGACACAATAACCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012382.1-1288s1c1
Sequence:CCGGGCGCTTAATATTTGCTGTCTTCTCGAGAAGACAGCAAATATTAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012382.1-717s1c1
Sequence:CCGGGTGATGAGATTGTTGCTGTTTCTCGAGAAACAGCAACAATCTCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012382.2-440s21c1
Sequence:CCGGATGAAATCACAGGTGCTAATGCTCGAGCATTAGCACCTGTGATTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012382.2-616s21c1
Sequence:CCGGCTATCCAATGAACCCTGAAATCTCGAGATTTCAGGGTTCATTGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012382.2-1081s21c1
Sequence:CCGGGCAGGATTATTGTATAGTGTTCTCGAGAACACTATACAATAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012382.2-415s21c1
Sequence:CCGGTCCAAATGATGCTACCCTATACTCGAGTATAGGGTAGCATCATTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012382.2-393s21c1
Sequence:CCGGGGGATGAAGCACTACAGTTAACTCGAGTTAACTGTAGTGCTTCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026213
VALIDATED
TTC33 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 33
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246575    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026213.3-1222s21c1
Sequence:CCGGAGTTAGCATCTTACGTGAAATCTCGAGATTTCACGTAAGATGCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026213.3-661s21c1
Sequence:CCGGCAAATAGCCCTGCACATATATCTCGAGATATATGTGCAGGGCTATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026213.3-967s21c1
Sequence:CCGGCCAGATGGCTCCGTCTTTATCCTCGAGGATAAAGACGGAGCCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026213.3-921s21c1
Sequence:CCGGTGGGACTGTAGAGATCGTAAACTCGAGTTTACGATCTCTACAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026213.3-610s21c1
Sequence:CCGGGGTCGAGCTCAGCTTGGATTACTCGAGTAATCCAAGCTGAGCTCGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026213
VALIDATED
TTC33 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 33
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246575    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026213.3-1222s21c1
Sequence:CCGGAGTTAGCATCTTACGTGAAATCTCGAGATTTCACGTAAGATGCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026213.3-661s21c1
Sequence:CCGGCAAATAGCCCTGCACATATATCTCGAGATATATGTGCAGGGCTATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026213.3-967s21c1
Sequence:CCGGCCAGATGGCTCCGTCTTTATCCTCGAGGATAAAGACGGAGCCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026213.3-921s21c1
Sequence:CCGGTGGGACTGTAGAGATCGTAAACTCGAGTTTACGATCTCTACAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026213.3-610s21c1
Sequence:CCGGGGTCGAGCTCAGCTTGGATTACTCGAGTAATCCAAGCTGAGCTCGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026213
VALIDATED
TTC33 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 33
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246575    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026213.3-1222s21c1
Sequence:CCGGAGTTAGCATCTTACGTGAAATCTCGAGATTTCACGTAAGATGCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026213.3-661s21c1
Sequence:CCGGCAAATAGCCCTGCACATATATCTCGAGATATATGTGCAGGGCTATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026213.3-967s21c1
Sequence:CCGGCCAGATGGCTCCGTCTTTATCCTCGAGGATAAAGACGGAGCCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026213.3-921s21c1
Sequence:CCGGTGGGACTGTAGAGATCGTAAACTCGAGTTTACGATCTCTACAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026213.3-610s21c1
Sequence:CCGGGGTCGAGCTCAGCTTGGATTACTCGAGTAATCCAAGCTGAGCTCGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks