EMAIL THIS PAGE TO A FRIEND

TTC34

tetratricopeptide repeat domain 34

UniProtKB ID: A8MYJ7, A8MXL8
Gene ID:
Mouse(242800) tetratricopeptide repeat domain 34
Rat(366517) tetratricopeptide repeat domain 34
cow(525122) tetratricopeptide repeat domain 34
sheep(101120260) tetratricopeptide repeat domain 34
naked mole-rat(101722641) tetratricopeptide repeat domain 34
chicken(100857353) tetratricopeptide repeat domain 34
dog(489618) uncharacterized LOC489618
38 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172878 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172878 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172878 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001077214 Rosetta Predictions rat pricing
XM_345615 Rosetta Predictions rat pricing
NM_172878 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077214 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356204 predicted 2186
2 SASI_Rn02_00356205 predicted 2676
3 SASI_Rn02_00356206 predicted 2070
4 SASI_Rn02_00356207 predicted 1995
5 SASI_Rn02_00356208 predicted 683
6 SASI_Rn02_00356209 predicted 1788
7 SASI_Rn02_00356210 predicted 2757
8 SASI_Rn02_00356211 predicted 3070
9 SASI_Rn02_00356212 predicted 699
10 SASI_Rn02_00356213 predicted 1792
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345615 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398543 predicted 462
2 SASI_Rn02_00398544 predicted 297
3 SASI_Rn02_00398545 predicted 289
4 SASI_Rn02_00398546 predicted 460
5 SASI_Rn02_00398547 predicted 209
6 SASI_Rn02_00398548 predicted 465
7 SASI_Rn02_00398549 predicted 288
8 SASI_Rn02_00398550 predicted 196
9 SASI_Rn02_00398551 predicted 3067
10 SASI_Rn02_00398552 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172878 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115000 predicted 742
2 SASI_Mm02_00344845 predicted 1229
3 SASI_Mm02_00344846 predicted 744
4 SASI_Mm01_00115002 predicted 415
5 SASI_Mm01_00115003 predicted 1210
6 SASI_Mm01_00115004 predicted 495
7 SASI_Mm01_00115005 predicted 304
8 SASI_Mm02_00344847 predicted 328
9 SASI_Mm01_00115007 predicted 302
10 SASI_Mm01_00115008 predicted 512
11 SASI_Mm01_00115001 predicted 638
12 SASI_Mm01_00115006 predicted 1268
13 SASI_Mm01_00115009 predicted 1726
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172878
TTC34 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 34
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172878.2-311s21c1
Sequence:CCGGGATGCCAACCAGCTAGTAAAGCTCGAGCTTTACTAGCTGGTTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172878.2-2559s21c1
Sequence:CCGGTGAAGTGACTGGATAGGATTACTCGAGTAATCCTATCCAGTCACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172878.2-1197s21c1
Sequence:CCGGCAAGCAACATCTTGGATTTAGCTCGAGCTAAATCCAAGATGTTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172878.2-201s21c1
Sequence:CCGGGTCTGGATGATGCTCACAAATCTCGAGATTTGTGAGCATCATCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172878.2-1689s21c1
Sequence:CCGGCTGGCTGCAGACTACACTAACCTCGAGGTTAGTGTAGTCTGCAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202280    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172878.1-2326s1c1
Sequence:CCGGGCAGTGATGAAGTGACTGGATCTCGAGATCCAGTCACTTCATCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172878.1-885s1c1
Sequence:CCGGCCTGAAGACAGAAGTTCAGTTCTCGAGAACTGAACTTCTGTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172878.1-1318s1c1
Sequence:CCGGGCAAGCAACATCTTGGATTTACTCGAGTAAATCCAAGATGTTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172878
TTC34 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 34
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172878.2-311s21c1
Sequence:CCGGGATGCCAACCAGCTAGTAAAGCTCGAGCTTTACTAGCTGGTTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172878.2-2559s21c1
Sequence:CCGGTGAAGTGACTGGATAGGATTACTCGAGTAATCCTATCCAGTCACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172878.2-1197s21c1
Sequence:CCGGCAAGCAACATCTTGGATTTAGCTCGAGCTAAATCCAAGATGTTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172878.2-201s21c1
Sequence:CCGGGTCTGGATGATGCTCACAAATCTCGAGATTTGTGAGCATCATCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172878.2-1689s21c1
Sequence:CCGGCTGGCTGCAGACTACACTAACCTCGAGGTTAGTGTAGTCTGCAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202280    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172878.1-2326s1c1
Sequence:CCGGGCAGTGATGAAGTGACTGGATCTCGAGATCCAGTCACTTCATCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172878.1-885s1c1
Sequence:CCGGCCTGAAGACAGAAGTTCAGTTCTCGAGAACTGAACTTCTGTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172878.1-1318s1c1
Sequence:CCGGGCAAGCAACATCTTGGATTTACTCGAGTAAATCCAAGATGTTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172878
TTC34 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 34
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172878.2-311s21c1
Sequence:CCGGGATGCCAACCAGCTAGTAAAGCTCGAGCTTTACTAGCTGGTTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172878.2-2559s21c1
Sequence:CCGGTGAAGTGACTGGATAGGATTACTCGAGTAATCCTATCCAGTCACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172878.2-1197s21c1
Sequence:CCGGCAAGCAACATCTTGGATTTAGCTCGAGCTAAATCCAAGATGTTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172878.2-201s21c1
Sequence:CCGGGTCTGGATGATGCTCACAAATCTCGAGATTTGTGAGCATCATCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172878.2-1689s21c1
Sequence:CCGGCTGGCTGCAGACTACACTAACCTCGAGGTTAGTGTAGTCTGCAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202280    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172878.1-2326s1c1
Sequence:CCGGGCAGTGATGAAGTGACTGGATCTCGAGATCCAGTCACTTCATCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172878.1-885s1c1
Sequence:CCGGCCTGAAGACAGAAGTTCAGTTCTCGAGAACTGAACTTCTGTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172878.1-1318s1c1
Sequence:CCGGGCAAGCAACATCTTGGATTTACTCGAGTAAATCCAAGATGTTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks