EMAIL THIS PAGE TO A FRIEND

TTC36

tetratricopeptide repeat domain 36

Synonyms: HBP21
UniProtKB ID: A6NLP5, B9EJD8
Gene ID:
Mouse(192653) tetratricopeptide repeat domain 36
Rat(300676) tetratricopeptide repeat domain 36
Zebrafish(492516) tetratricopeptide repeat domain 36
domestic cat(101083364) tetratricopeptide repeat domain 36
dog(489382) tetratricopeptide repeat domain 36
chicken(419757) tetratricopeptide repeat domain 36
naked mole-rat(101716312) tetratricopeptide repeat domain 36
domestic guinea pig(100725397) tetratricopeptide repeat domain 36
cow(510592) tetratricopeptide repeat domain 36
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA038731 Anti-TTC36 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138951 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138951 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138951 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080441 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080441 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080441 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080441 Rosetta Predictions human pricing
XM_084672 Rosetta Predictions human pricing
XM_932933 Rosetta Predictions human pricing
NM_001005546 Rosetta Predictions rat pricing
NM_138951 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314876 predicted 237
2 SASI_Hs02_00314877 predicted 280
3 SASI_Hs02_00314878 predicted 420
4 SASI_Hs02_00314879 predicted 300
5 SASI_Hs02_00314880 predicted 301
6 SASI_Hs02_00314881 predicted 504
7 SASI_Hs02_00314882 predicted 598
8 SASI_Hs02_00314883 predicted 195
9 SASI_Hs02_00314884 predicted 22
10 SASI_Hs02_00314885 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_084672 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00276484 predicted 605
2 SASI_Hs01_00276485 predicted 212
3 SASI_Hs01_00276486 predicted 282
4 SASI_Hs01_00276487 predicted 428
5 SASI_Hs01_00276488 predicted 304
6 SASI_Hs01_00276489 predicted 314
7 SASI_Hs01_00276490 predicted 513
8 SASI_Hs01_00276491 predicted 607
9 SASI_Hs01_00276492 predicted 198
10 SASI_Hs01_00276493 predicted 26
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932933 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00286216 predicted 818
2 SASI_Hs01_00286217 predicted 510
3 SASI_Hs01_00286218 predicted 624
4 SASI_Hs01_00286219 predicted 488
5 SASI_Hs01_00286220 predicted 487
6 SASI_Hs01_00286221 predicted 489
7 SASI_Hs01_00286222 predicted 716
8 SASI_Hs01_00286223 predicted 810
9 SASI_Hs01_00286224 predicted 482
10 SASI_Hs01_00286225 predicted 837
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005546 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198404 predicted 375
2 SASI_Rn01_00094967 predicted 238
3 SASI_Rn01_00094968 predicted 353
4 SASI_Rn02_00198405 predicted 213
5 SASI_Rn01_00094970 predicted 202
6 SASI_Rn01_00094971 predicted 362
7 SASI_Rn01_00094972 predicted 336
8 SASI_Rn01_00094973 predicted 379
9 SASI_Rn01_00094974 predicted 267
10 SASI_Rn01_00094975 predicted 343
11 SASI_Rn01_00094969 predicted 313
12 SASI_Rn01_00094976 predicted 370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138951 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027563 predicted 288
2 SASI_Mm01_00027565 predicted 359
3 SASI_Mm01_00027566 predicted 352
4 SASI_Mm01_00027567 predicted 365
5 SASI_Mm02_00339842 predicted 317
6 SASI_Mm01_00027568 predicted 247
7 SASI_Mm01_00027569 predicted 263
8 SASI_Mm01_00027570 predicted 332
9 SASI_Mm01_00027571 predicted 331
10 SASI_Mm01_00027572 predicted 379
11 SASI_Mm01_00027564 predicted 302
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138951
TTC36 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 36
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138951.1-382s1c1
Sequence:CCGGGCCTACAACAACCGAGCCCAACTCGAGTTGGGCTCGGTTGTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138951.1-188s1c1
Sequence:CCGGCCTTTGGAGATGTTGTTGGATCTCGAGATCCAACAACATCTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138951.1-199s1c1
Sequence:CCGGGTTGTTGGATTGGACCTGGAACTCGAGTTCCAGGTCCAATCCAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138951.1-164s1c1
Sequence:CCGGAGGCCATCTTCAACCCTGATACTCGAGTATCAGGGTTGAAGATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138951.1-508s1c1
Sequence:CCGGAGCGGGCTACTGGCGAGATTTCTCGAGAAATCTCGCCAGTAGCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138951
TTC36 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 36
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138951.1-382s1c1
Sequence:CCGGGCCTACAACAACCGAGCCCAACTCGAGTTGGGCTCGGTTGTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138951.1-188s1c1
Sequence:CCGGCCTTTGGAGATGTTGTTGGATCTCGAGATCCAACAACATCTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138951.1-199s1c1
Sequence:CCGGGTTGTTGGATTGGACCTGGAACTCGAGTTCCAGGTCCAATCCAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138951.1-164s1c1
Sequence:CCGGAGGCCATCTTCAACCCTGATACTCGAGTATCAGGGTTGAAGATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138951.1-508s1c1
Sequence:CCGGAGCGGGCTACTGGCGAGATTTCTCGAGAAATCTCGCCAGTAGCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138951
TTC36 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 36
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138951.1-382s1c1
Sequence:CCGGGCCTACAACAACCGAGCCCAACTCGAGTTGGGCTCGGTTGTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138951.1-188s1c1
Sequence:CCGGCCTTTGGAGATGTTGTTGGATCTCGAGATCCAACAACATCTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138951.1-199s1c1
Sequence:CCGGGTTGTTGGATTGGACCTGGAACTCGAGTTCCAGGTCCAATCCAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138951.1-164s1c1
Sequence:CCGGAGGCCATCTTCAACCCTGATACTCGAGTATCAGGGTTGAAGATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138951.1-508s1c1
Sequence:CCGGAGCGGGCTACTGGCGAGATTTCTCGAGAAATCTCGCCAGTAGCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080441
TTC36 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 36
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080441.1-33s21c1
Sequence:CCGGGGCCATCTTCAACCCTGACACCTCGAGGTGTCAGGGTTGAAGATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080441.1-58s21c1
Sequence:CCGGTTTGGAGACATTGTTGGATTGCTCGAGCAATCCAACAATGTCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080441.1-248s21c1
Sequence:CCGGAGAGGGCTTCAGCCTACAACACTCGAGTGTTGTAGGCTGAAGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080441.1-132s21c1
Sequence:CCGGTCAAGCACAGCTGGAACAGTCCTCGAGGACTGTTCCAGCTGTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080441.1-80s21c1
Sequence:CCGGACCTCGGAGAGGAAGCAGAAACTCGAGTTTCTGCTTCCTCTCCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080441
TTC36 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 36
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080441.1-33s21c1
Sequence:CCGGGGCCATCTTCAACCCTGACACCTCGAGGTGTCAGGGTTGAAGATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080441.1-58s21c1
Sequence:CCGGTTTGGAGACATTGTTGGATTGCTCGAGCAATCCAACAATGTCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080441.1-248s21c1
Sequence:CCGGAGAGGGCTTCAGCCTACAACACTCGAGTGTTGTAGGCTGAAGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080441.1-132s21c1
Sequence:CCGGTCAAGCACAGCTGGAACAGTCCTCGAGGACTGTTCCAGCTGTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080441.1-80s21c1
Sequence:CCGGACCTCGGAGAGGAAGCAGAAACTCGAGTTTCTGCTTCCTCTCCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080441
TTC36 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 36
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080441.1-33s21c1
Sequence:CCGGGGCCATCTTCAACCCTGACACCTCGAGGTGTCAGGGTTGAAGATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080441.1-58s21c1
Sequence:CCGGTTTGGAGACATTGTTGGATTGCTCGAGCAATCCAACAATGTCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080441.1-248s21c1
Sequence:CCGGAGAGGGCTTCAGCCTACAACACTCGAGTGTTGTAGGCTGAAGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080441.1-132s21c1
Sequence:CCGGTCAAGCACAGCTGGAACAGTCCTCGAGGACTGTTCCAGCTGTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080441.1-80s21c1
Sequence:CCGGACCTCGGAGAGGAAGCAGAAACTCGAGTTTCTGCTTCCTCTCCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks