EMAIL THIS PAGE TO A FRIEND

TTC37

tetratricopeptide repeat domain 37

Synonyms: KIAA0372 Ski3
UniProtKB ID: Q6PGP7, O15077, Q6PJI3
Gene ID:
Human(9652) Summary: This gene encodes a protein with twenty tetratricopeptide (TPR) repeats. Tetratricopeptide repeat containing motifs are found in a variety of proteins and may mediate protein-protein interactions and chaperone activity. Mutations in this gene are associated with trichohepatoenteric syndrome. [provided by RefSeq, Jul 2010]
Mouse(218343) tetratricopeptide repeat domain 37
Rat(294595) tetratricopeptide repeat domain 37
cow(534095) tetratricopeptide repeat domain 37
sheep(101109091) tetratricopeptide repeat domain 37
domestic guinea pig(100718450) tetratricopeptide repeat domain 37
naked mole-rat(101697569) tetratricopeptide repeat domain 37
Domestic Rabbit(100343902) tetratricopeptide repeat domain 37
chicken(427114) tetratricopeptide repeat domain 37
Horse(100065001) tetratricopeptide repeat domain 37
domestic cat(101087708) tetratricopeptide repeat domain 37
dog(479150) tetratricopeptide repeat domain 37
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA037905 Anti-TTC37 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081352 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081352 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081352 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014639 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014639 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014639 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014639 Rosetta Predictions human pricing
XM_001059136 Rosetta Predictions rat pricing
XM_226606 Rosetta Predictions rat pricing
NM_001081352 Rosetta Predictions mouse pricing
XM_898433 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014639 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010354 predicted 3875
2 SASI_Hs01_00010355 predicted 915
3 SASI_Hs01_00010356 predicted 3479
4 SASI_Hs01_00010357 predicted 2061
5 SASI_Hs01_00010358 predicted 4592
6 SASI_Hs02_00345951 predicted 2654
7 SASI_Hs01_00010360 predicted 4119
8 SASI_Hs01_00010361 predicted 3973
9 SASI_Hs01_00010362 predicted 4834
10 SASI_Hs02_00345952 predicted 3064
11 SASI_Hs01_00010353 predicted 2027
12 SASI_Hs01_00010359 predicted 847
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059136 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292092 predicted 1591
2 SASI_Rn02_00292093 predicted 1379
3 SASI_Rn02_00292094 predicted 968
4 SASI_Rn02_00292095 predicted 3269
5 SASI_Rn02_00292096 predicted 3212
6 SASI_Rn02_00292097 predicted 2593
7 SASI_Rn02_00292098 predicted 2410
8 SASI_Rn02_00292099 predicted 4321
9 SASI_Rn02_00292100 predicted 568
10 SASI_Rn02_00292101 predicted 3035
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226606 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383725 predicted 1591
2 SASI_Rn02_00383726 predicted 1384
3 SASI_Rn02_00383727 predicted 966
4 SASI_Rn02_00383728 predicted 3266
5 SASI_Rn02_00383729 predicted 3216
6 SASI_Rn02_00383730 predicted 2593
7 SASI_Rn02_00383731 predicted 2406
8 SASI_Rn02_00383732 predicted 560
9 SASI_Rn02_00383733 predicted 3030
10 SASI_Rn02_00383734 predicted 2778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081352 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297571 predicted 1762
2 SASI_Mm02_00297572 predicted 714
3 SASI_Mm02_00297573 predicted 2130
4 SASI_Mm02_00297574 predicted 3652
5 SASI_Mm02_00297575 predicted 2969
6 SASI_Mm02_00297576 predicted 1193
7 SASI_Mm02_00297577 predicted 1067
8 SASI_Mm02_00297578 predicted 1867
9 SASI_Mm02_00297579 predicted 2851
10 SASI_Mm02_00297580 predicted 2985
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898433 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00211827 predicted 720
2 SASI_Mm01_00211828 predicted 2140
3 SASI_Mm01_00211829 predicted 3657
4 SASI_Mm01_00211830 predicted 2979
5 SASI_Mm01_00211831 predicted 1203
6 SASI_Mm01_00211832 predicted 1075
7 SASI_Mm01_00211833 predicted 1868
8 SASI_Mm01_00211834 predicted 2850
9 SASI_Mm01_00211835 predicted 2992
10 SASI_Mm01_00211836 predicted 2176
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081352
VALIDATED
TTC37 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 37
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000251737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081352.1-3835s21c1
Sequence:CCGGTCAAACGCAGAAACGATTATCCTCGAGGATAATCGTTTCTGCGTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081352.1-5141s21c1
Sequence:CCGGTCTCACCAGAACAGCGTATTTCTCGAGAAATACGCTGTTCTGGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081352.1-1867s21c1
Sequence:CCGGTCTGCTACTTAGGCCATTATTCTCGAGAATAATGGCCTAAGTAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081352.1-1202s21c1
Sequence:CCGGCCTTATTGGCTTAGGCATTATCTCGAGATAATGCCTAAGCCAATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081352
VALIDATED
TTC37 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 37
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000251737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081352.1-3835s21c1
Sequence:CCGGTCAAACGCAGAAACGATTATCCTCGAGGATAATCGTTTCTGCGTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081352.1-5141s21c1
Sequence:CCGGTCTCACCAGAACAGCGTATTTCTCGAGAAATACGCTGTTCTGGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081352.1-1867s21c1
Sequence:CCGGTCTGCTACTTAGGCCATTATTCTCGAGAATAATGGCCTAAGTAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081352.1-1202s21c1
Sequence:CCGGCCTTATTGGCTTAGGCATTATCTCGAGATAATGCCTAAGCCAATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081352
VALIDATED
TTC37 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 37
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000251737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081352.1-3835s21c1
Sequence:CCGGTCAAACGCAGAAACGATTATCCTCGAGGATAATCGTTTCTGCGTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081352.1-5141s21c1
Sequence:CCGGTCTCACCAGAACAGCGTATTTCTCGAGAAATACGCTGTTCTGGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081352.1-1867s21c1
Sequence:CCGGTCTGCTACTTAGGCCATTATTCTCGAGAATAATGGCCTAAGTAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081352.1-1202s21c1
Sequence:CCGGCCTTATTGGCTTAGGCATTATCTCGAGATAATGCCTAAGCCAATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014639
VALIDATED
TTC37 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 37
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014639.2-3547s1c1
Sequence:CCGGGCTCTGGCAATAACTGAATATCTCGAGATATTCAGTTATTGCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014639.2-1264s1c1
Sequence:CCGGGCTCTGAAGATCGTAGATAATCTCGAGATTATCTACGATCTTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143237    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014639.2-5002s1c1
Sequence:CCGGGCTGTAAGAATGAAGCAATGACTCGAGTCATTGCTTCATTCTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014639.2-4804s1c1
Sequence:CCGGCCTGGGTATCCCAAATCTATTCTCGAGAATAGATTTGGGATACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014639.2-3919s1c1
Sequence:CCGGGCAGGAAATGTGGCTCATATTCTCGAGAATATGAGCCACATTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014639.2-469s1c1
Sequence:CCGGGCTGAATTAGAGCCAGACCAACTCGAGTTGGTCTGGCTCTAATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014639.2-2023s1c1
Sequence:CCGGGCTGATTTACAGGCAGCATTACTCGAGTAATGCTGCCTGTAAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014639.2-4864s1c1
Sequence:CCGGGCCAAAGATGACTATGAGCTTCTCGAGAAGCTCATAGTCATCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_014639.2-1414s1c1
Sequence:CCGGGCAGATAATATCCCAGGACTTCTCGAGAAGTCCTGGGATATTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014639.2-3755s1c1
Sequence:CCGGGCCTTCTTACATCAGCGATTTCTCGAGAAATCGCTGATGTAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014639.2-3756s1c1
Sequence:CCGGCCTTCTTACATCAGCGATTTACTCGAGTAAATCGCTGATGTAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014639.2-1977s1c1
Sequence:CCGGGCGAGGACTATACTATTTGAACTCGAGTTCAAATAGTATAGTCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014639
VALIDATED
TTC37 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 37
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014639.2-3547s1c1
Sequence:CCGGGCTCTGGCAATAACTGAATATCTCGAGATATTCAGTTATTGCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014639.2-1264s1c1
Sequence:CCGGGCTCTGAAGATCGTAGATAATCTCGAGATTATCTACGATCTTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143237    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014639.2-5002s1c1
Sequence:CCGGGCTGTAAGAATGAAGCAATGACTCGAGTCATTGCTTCATTCTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014639.2-4804s1c1
Sequence:CCGGCCTGGGTATCCCAAATCTATTCTCGAGAATAGATTTGGGATACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014639.2-3919s1c1
Sequence:CCGGGCAGGAAATGTGGCTCATATTCTCGAGAATATGAGCCACATTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014639.2-469s1c1
Sequence:CCGGGCTGAATTAGAGCCAGACCAACTCGAGTTGGTCTGGCTCTAATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014639.2-2023s1c1
Sequence:CCGGGCTGATTTACAGGCAGCATTACTCGAGTAATGCTGCCTGTAAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014639.2-4864s1c1
Sequence:CCGGGCCAAAGATGACTATGAGCTTCTCGAGAAGCTCATAGTCATCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_014639.2-1414s1c1
Sequence:CCGGGCAGATAATATCCCAGGACTTCTCGAGAAGTCCTGGGATATTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014639.2-3755s1c1
Sequence:CCGGGCCTTCTTACATCAGCGATTTCTCGAGAAATCGCTGATGTAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014639.2-3756s1c1
Sequence:CCGGCCTTCTTACATCAGCGATTTACTCGAGTAAATCGCTGATGTAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014639.2-1977s1c1
Sequence:CCGGGCGAGGACTATACTATTTGAACTCGAGTTCAAATAGTATAGTCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014639
VALIDATED
TTC37 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 37
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014639.2-3547s1c1
Sequence:CCGGGCTCTGGCAATAACTGAATATCTCGAGATATTCAGTTATTGCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014639.2-1264s1c1
Sequence:CCGGGCTCTGAAGATCGTAGATAATCTCGAGATTATCTACGATCTTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143237    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014639.2-5002s1c1
Sequence:CCGGGCTGTAAGAATGAAGCAATGACTCGAGTCATTGCTTCATTCTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014639.2-4804s1c1
Sequence:CCGGCCTGGGTATCCCAAATCTATTCTCGAGAATAGATTTGGGATACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014639.2-3919s1c1
Sequence:CCGGGCAGGAAATGTGGCTCATATTCTCGAGAATATGAGCCACATTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014639.2-469s1c1
Sequence:CCGGGCTGAATTAGAGCCAGACCAACTCGAGTTGGTCTGGCTCTAATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014639.2-2023s1c1
Sequence:CCGGGCTGATTTACAGGCAGCATTACTCGAGTAATGCTGCCTGTAAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014639.2-4864s1c1
Sequence:CCGGGCCAAAGATGACTATGAGCTTCTCGAGAAGCTCATAGTCATCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_014639.2-1414s1c1
Sequence:CCGGGCAGATAATATCCCAGGACTTCTCGAGAAGTCCTGGGATATTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014639.2-3755s1c1
Sequence:CCGGGCCTTCTTACATCAGCGATTTCTCGAGAAATCGCTGATGTAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014639.2-3756s1c1
Sequence:CCGGCCTTCTTACATCAGCGATTTACTCGAGTAAATCGCTGATGTAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014639.2-1977s1c1
Sequence:CCGGGCGAGGACTATACTATTTGAACTCGAGTTCAAATAGTATAGTCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks