EMAIL THIS PAGE TO A FRIEND

TTC38

tetratricopeptide repeat domain 38

UniProtKB ID: Q5R3I4, Q8WV27, Q9NWP8
Gene ID:
Mouse(239570) tetratricopeptide repeat domain 38
Rat(300125) tetratricopeptide repeat domain 38
Zebrafish(553728) tetratricopeptide repeat domain 38
dog(474465) tetratricopeptide repeat domain 38
Horse(100053315) tetratricopeptide repeat domain 38
domestic cat(101097075) tetratricopeptide repeat domain 38
chicken(426193) tetratricopeptide repeat domain 38
naked mole-rat(101724053) tetratricopeptide repeat domain 38
domestic guinea pig(100723588) tetratricopeptide repeat domain 38
cow(616471) tetratricopeptide repeat domain 38
sheep(101110320) tetratricopeptide repeat domain 38
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017931 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017931 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017931 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033337 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033337 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033337 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017931 Rosetta Predictions human pricing
NM_001130499 Rosetta Predictions rat pricing
NM_001033337 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017931 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350932 predicted 1576
2 SASI_Hs02_00350933 predicted 1338
3 SASI_Hs01_00187616 predicted 252
4 SASI_Hs02_00350934 predicted 1330
5 SASI_Hs01_00187618 predicted 650
6 SASI_Hs01_00187619 predicted 676
7 SASI_Hs01_00187623 predicted 356
8 SASI_Hs01_00187624 predicted 558
9 SASI_Hs02_00350935 predicted 1350
10 SASI_Hs01_00187625 predicted 550
11 SASI_Hs01_00187617 predicted 515
12 SASI_Hs01_00187620 predicted 311
13 SASI_Hs01_00187621 predicted 456
14 SASI_Hs01_00187622 predicted 609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130499 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255419 predicted 1012
2 SASI_Rn02_00255420 predicted 808
3 SASI_Rn02_00255421 predicted 877
4 SASI_Rn02_00255422 predicted 343
5 SASI_Rn02_00255423 predicted 619
6 SASI_Rn02_00255424 predicted 888
7 SASI_Rn02_00255425 predicted 1255
8 SASI_Rn02_00255426 predicted 649
9 SASI_Rn02_00255427 predicted 1272
10 SASI_Rn02_00255428 predicted 869
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033337 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288589 predicted 627
2 SASI_Mm01_00080151 predicted 1566
3 SASI_Mm01_00080152 predicted 755
4 SASI_Mm01_00080153 predicted 719
5 SASI_Mm01_00080154 predicted 893
6 SASI_Mm01_00080155 predicted 821
7 SASI_Mm01_00080157 predicted 901
8 SASI_Mm02_00288590 predicted 625
9 SASI_Mm01_00080158 predicted 1017
10 SASI_Mm02_00288591 predicted 656
11 SASI_Mm01_00080149 predicted 1430
12 SASI_Mm01_00080150 predicted 1397
13 SASI_Mm01_00080156 predicted 373
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017931
VALIDATED
TTC38 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 38
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017931.1-1018s1c1
Sequence:CCGGGCTGTTCAATGACGCACACTTCTCGAGAAGTGTGCGTCATTGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017931.1-848s1c1
Sequence:CCGGGACCATCTACGATACCCACATCTCGAGATGTGGGTATCGTAGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017931.1-517s1c1
Sequence:CCGGGAGATTCTGTTGCTCGAATTTCTCGAGAAATTCGAGCAACAGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017931.1-693s1c1
Sequence:CCGGGCTCACATCCACGAGATGAAACTCGAGTTTCATCTCGTGGATGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017931.1-390s1c1
Sequence:CCGGGCCAATGGGAACTTTCCGAAACTCGAGTTTCGGAAAGTTCCCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017931.2-434s21c1
Sequence:CCGGGCCAATGGGAACTTTCCGAAACTCGAGTTTCGGAAAGTTCCCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017931.2-561s21c1
Sequence:CCGGGAGATTCTGTTGCTCGAATTTCTCGAGAAATTCGAGCAACAGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017931.2-860s21c1
Sequence:CCGGCTGATTGAGAAGGGCGAATATCTCGAGATATTCGCCCTTCTCAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017931.2-1626s21c1
Sequence:CCGGGAAGTGGGTCACGGGTTAATTCTCGAGAATTAACCCGTGACCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017931.2-822s21c1
Sequence:CCGGTGTTGGCTTGTCATAACTATTCTCGAGAATAGTTATGACAAGCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017931
VALIDATED
TTC38 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 38
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017931.1-1018s1c1
Sequence:CCGGGCTGTTCAATGACGCACACTTCTCGAGAAGTGTGCGTCATTGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017931.1-848s1c1
Sequence:CCGGGACCATCTACGATACCCACATCTCGAGATGTGGGTATCGTAGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017931.1-517s1c1
Sequence:CCGGGAGATTCTGTTGCTCGAATTTCTCGAGAAATTCGAGCAACAGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017931.1-693s1c1
Sequence:CCGGGCTCACATCCACGAGATGAAACTCGAGTTTCATCTCGTGGATGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017931.1-390s1c1
Sequence:CCGGGCCAATGGGAACTTTCCGAAACTCGAGTTTCGGAAAGTTCCCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017931.2-434s21c1
Sequence:CCGGGCCAATGGGAACTTTCCGAAACTCGAGTTTCGGAAAGTTCCCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017931.2-561s21c1
Sequence:CCGGGAGATTCTGTTGCTCGAATTTCTCGAGAAATTCGAGCAACAGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017931.2-860s21c1
Sequence:CCGGCTGATTGAGAAGGGCGAATATCTCGAGATATTCGCCCTTCTCAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017931.2-1626s21c1
Sequence:CCGGGAAGTGGGTCACGGGTTAATTCTCGAGAATTAACCCGTGACCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017931.2-822s21c1
Sequence:CCGGTGTTGGCTTGTCATAACTATTCTCGAGAATAGTTATGACAAGCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017931
VALIDATED
TTC38 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 38
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017931.1-1018s1c1
Sequence:CCGGGCTGTTCAATGACGCACACTTCTCGAGAAGTGTGCGTCATTGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017931.1-848s1c1
Sequence:CCGGGACCATCTACGATACCCACATCTCGAGATGTGGGTATCGTAGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017931.1-517s1c1
Sequence:CCGGGAGATTCTGTTGCTCGAATTTCTCGAGAAATTCGAGCAACAGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017931.1-693s1c1
Sequence:CCGGGCTCACATCCACGAGATGAAACTCGAGTTTCATCTCGTGGATGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017931.1-390s1c1
Sequence:CCGGGCCAATGGGAACTTTCCGAAACTCGAGTTTCGGAAAGTTCCCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017931.2-434s21c1
Sequence:CCGGGCCAATGGGAACTTTCCGAAACTCGAGTTTCGGAAAGTTCCCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017931.2-561s21c1
Sequence:CCGGGAGATTCTGTTGCTCGAATTTCTCGAGAAATTCGAGCAACAGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017931.2-860s21c1
Sequence:CCGGCTGATTGAGAAGGGCGAATATCTCGAGATATTCGCCCTTCTCAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017931.2-1626s21c1
Sequence:CCGGGAAGTGGGTCACGGGTTAATTCTCGAGAATTAACCCGTGACCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017931.2-822s21c1
Sequence:CCGGTGTTGGCTTGTCATAACTATTCTCGAGAATAGTTATGACAAGCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033337
TTC38 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 38
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033337.4-2834s21c1
Sequence:CCGGCATAGCCATCACGAGGTTTAACTCGAGTTAAACCTCGTGATGGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033337.4-622s21c1
Sequence:CCGGGCTACGTGAAAGGCATCTATTCTCGAGAATAGATGCCTTTCACGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033337.4-1249s21c1
Sequence:CCGGGAAACCCTGACCGAGTCTTAGCTCGAGCTAAGACTCGGTCAGGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033337.4-1279s21c1
Sequence:CCGGTGCCAATCCGATACCGAATTGCTCGAGCAATTCGGTATCGGATTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033337.4-881s21c1
Sequence:CCGGAGACTATGAGGCCGCACTAACCTCGAGGTTAGTGCGGCCTCATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033337
TTC38 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 38
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033337.4-2834s21c1
Sequence:CCGGCATAGCCATCACGAGGTTTAACTCGAGTTAAACCTCGTGATGGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033337.4-622s21c1
Sequence:CCGGGCTACGTGAAAGGCATCTATTCTCGAGAATAGATGCCTTTCACGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033337.4-1249s21c1
Sequence:CCGGGAAACCCTGACCGAGTCTTAGCTCGAGCTAAGACTCGGTCAGGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033337.4-1279s21c1
Sequence:CCGGTGCCAATCCGATACCGAATTGCTCGAGCAATTCGGTATCGGATTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033337.4-881s21c1
Sequence:CCGGAGACTATGAGGCCGCACTAACCTCGAGGTTAGTGCGGCCTCATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033337
TTC38 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 38
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033337.4-2834s21c1
Sequence:CCGGCATAGCCATCACGAGGTTTAACTCGAGTTAAACCTCGTGATGGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033337.4-622s21c1
Sequence:CCGGGCTACGTGAAAGGCATCTATTCTCGAGAATAGATGCCTTTCACGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033337.4-1249s21c1
Sequence:CCGGGAAACCCTGACCGAGTCTTAGCTCGAGCTAAGACTCGGTCAGGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033337.4-1279s21c1
Sequence:CCGGTGCCAATCCGATACCGAATTGCTCGAGCAATTCGGTATCGGATTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033337.4-881s21c1
Sequence:CCGGAGACTATGAGGCCGCACTAACCTCGAGGTTAGTGCGGCCTCATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks