EMAIL THIS PAGE TO A FRIEND

TTC39A

tetratricopeptide repeat domain 39A

Synonyms: C1orf34 DEME-6
Gene ID:
Mouse(230603) tetratricopeptide repeat domain 39A
Rat(298366) tetratricopeptide repeat domain 39A
cow(527172) tetratricopeptide repeat domain 39A
sheep(101110190) tetratricopeptide repeat domain 39A
domestic guinea pig(100721206) tetratricopeptide repeat domain 39A
naked mole-rat(101719366) tetratricopeptide repeat domain 39A
Zebrafish(100320357) tetratricopeptide repeat domain 39A
domestic cat(101087333) tetratricopeptide repeat domain 39A
dog(100683153) tetratricopeptide repeat domain 39A
chicken(424632) tetratricopeptide repeat domain 39A
162 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080494 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080494 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080494 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153392 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153392 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153392 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080494 Rosetta Predictions human pricing
XM_375729 Rosetta Predictions human pricing
XM_930328 Rosetta Predictions human pricing
XM_934649 Rosetta Predictions human pricing
XM_934652 Rosetta Predictions human pricing
XM_934654 Rosetta Predictions human pricing
XM_934656 Rosetta Predictions human pricing
XM_934658 Rosetta Predictions human pricing
NM_001134519 Rosetta Predictions rat pricing
XM_216483 Rosetta Predictions rat pricing
NM_153392 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080494 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315385 predicted 1421
2 SASI_Hs02_00315386 predicted 1082
3 SASI_Hs02_00315387 predicted 390
4 SASI_Hs02_00315388 predicted 1658
5 SASI_Hs02_00315389 predicted 260
6 SASI_Hs02_00315390 predicted 615
7 SASI_Hs02_00315391 predicted 1427
8 SASI_Hs02_00315392 predicted 945
9 SASI_Hs02_00315393 predicted 542
10 SASI_Hs02_00315394 predicted 570
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_375729 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00279722 predicted 2320
2 SASI_Hs01_00279723 predicted 2330
3 SASI_Hs01_00279724 predicted 1412
4 SASI_Hs01_00279725 predicted 2141
5 SASI_Hs01_00279726 predicted 2198
6 SASI_Hs01_00279727 predicted 2201
7 SASI_Hs01_00279728 predicted 1496
8 SASI_Hs01_00279729 predicted 1523
9 SASI_Hs01_00279730 predicted 2282
10 SASI_Hs01_00279731 predicted 1659
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930328 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00250133 predicted 2232
2 SASI_Hs01_00250134 predicted 2243
3 SASI_Hs01_00250135 predicted 1324
4 SASI_Hs01_00250136 predicted 2062
5 SASI_Hs01_00250137 predicted 2117
6 SASI_Hs01_00250138 predicted 2117
7 SASI_Hs01_00250139 predicted 1414
8 SASI_Hs01_00250140 predicted 1441
9 SASI_Hs01_00250141 predicted 2196
10 SASI_Hs01_00250142 predicted 1568
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00292164 predicted 1087
2 SASI_Hs01_00292165 predicted 1153
3 SASI_Hs01_00292166 predicted 777
4 SASI_Hs01_00292167 predicted 1013
5 SASI_Hs01_00292168 predicted 1172
6 SASI_Hs01_00292169 predicted 372
7 SASI_Hs01_00292170 predicted 239
8 SASI_Hs01_00292171 predicted 1044
9 SASI_Hs01_00292172 predicted 689
10 SASI_Hs01_00292173 predicted 1008
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934652 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00256769 predicted 1242
2 SASI_Hs01_00256770 predicted 1105
3 SASI_Hs01_00256771 predicted 1253
4 SASI_Hs01_00256772 predicted 1132
5 SASI_Hs01_00256773 predicted 499
6 SASI_Hs01_00256774 predicted 1202
7 SASI_Hs01_00256775 predicted 580
8 SASI_Hs01_00256776 predicted 1097
9 SASI_Hs01_00256777 predicted 424
10 SASI_Hs01_00256778 predicted 1256
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934654 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00294630 predicted 1378
2 SASI_Hs01_00294631 predicted 1386
3 SASI_Hs01_00294632 predicted 464
4 SASI_Hs01_00294633 predicted 1205
5 SASI_Hs01_00294634 predicted 1255
6 SASI_Hs01_00294635 predicted 1263
7 SASI_Hs01_00294636 predicted 558
8 SASI_Hs01_00294637 predicted 574
9 SASI_Hs01_00294638 predicted 1331
10 SASI_Hs01_00294639 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934656 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00290473 predicted 1697
2 SASI_Hs01_00290474 predicted 1700
3 SASI_Hs01_00290475 predicted 786
4 SASI_Hs01_00290476 predicted 1525
5 SASI_Hs01_00290477 predicted 1577
6 SASI_Hs01_00290478 predicted 1577
7 SASI_Hs01_00290479 predicted 873
8 SASI_Hs01_00290480 predicted 890
9 SASI_Hs01_00290481 predicted 1650
10 SASI_Hs01_00290482 predicted 1027
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00280142 predicted 2304
2 SASI_Hs01_00280143 predicted 2315
3 SASI_Hs01_00280144 predicted 1394
4 SASI_Hs01_00280145 predicted 2123
5 SASI_Hs01_00280146 predicted 2192
6 SASI_Hs01_00280147 predicted 2188
7 SASI_Hs01_00280148 predicted 1482
8 SASI_Hs01_00280149 predicted 1505
9 SASI_Hs01_00280150 predicted 2262
10 SASI_Hs01_00280151 predicted 1636
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134519 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256679 predicted 892
2 SASI_Rn02_00256680 predicted 1554
3 SASI_Rn02_00256681 predicted 417
4 SASI_Rn02_00256682 predicted 902
5 SASI_Rn02_00256683 predicted 1015
6 SASI_Rn02_00256684 predicted 987
7 SASI_Rn02_00256685 predicted 1514
8 SASI_Rn02_00256686 predicted 1463
9 SASI_Rn02_00256687 predicted 1383
10 SASI_Rn02_00256688 predicted 1618
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216483 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00160349 predicted 1584
2 SASI_Rn01_00160350 predicted 451
3 SASI_Rn01_00160351 predicted 935
4 SASI_Rn01_00160352 predicted 1044
5 SASI_Rn01_00160353 predicted 1010
6 SASI_Rn01_00160354 predicted 1541
7 SASI_Rn01_00160355 predicted 1490
8 SASI_Rn01_00160356 predicted 1407
9 SASI_Rn01_00160357 predicted 1647
10 SASI_Rn01_00160358 predicted 1060
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153392 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068764 predicted 433
2 SASI_Mm01_00068767 predicted 907
3 SASI_Mm01_00068768 predicted 1579
4 SASI_Mm01_00068769 predicted 926
5 SASI_Mm01_00068771 predicted 1532
6 SASI_Mm01_00068772 predicted 538
7 SASI_Mm01_00068773 predicted 401
8 SASI_Mm02_00343168 predicted 1633
9 SASI_Mm02_00343169 predicted 1573
10 SASI_Mm02_00343170 predicted 1809
11 SASI_Mm01_00068765 predicted 1050
12 SASI_Mm01_00068766 predicted 1036
13 SASI_Mm01_00068770 predicted 1004
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080494
TTC39A MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 39A
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000267617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080494.1-551s21c1
Sequence:CCGGTCATCAAAGGCGGCATCAAAGCTCGAGCTTTGATGCCGCCTTTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080494.1-1230s21c1
Sequence:CCGGGGACGACGAAGTGGAATTATTCTCGAGAATAATTCCACTTCGTCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080494.1-1154s21c1
Sequence:CCGGGGTCCAAGGCCACCTACATTTCTCGAGAAATGTAGGTGGCCTTGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080494.1-1438s21c1
Sequence:CCGGATACTTGAGATTATCACTAAGCTCGAGCTTAGTGATAATCTCAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080494
TTC39A MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 39A
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000267617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080494.1-551s21c1
Sequence:CCGGTCATCAAAGGCGGCATCAAAGCTCGAGCTTTGATGCCGCCTTTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080494.1-1230s21c1
Sequence:CCGGGGACGACGAAGTGGAATTATTCTCGAGAATAATTCCACTTCGTCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080494.1-1154s21c1
Sequence:CCGGGGTCCAAGGCCACCTACATTTCTCGAGAAATGTAGGTGGCCTTGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080494.1-1438s21c1
Sequence:CCGGATACTTGAGATTATCACTAAGCTCGAGCTTAGTGATAATCTCAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080494
TTC39A MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 39A
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000267617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080494.1-551s21c1
Sequence:CCGGTCATCAAAGGCGGCATCAAAGCTCGAGCTTTGATGCCGCCTTTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080494.1-1230s21c1
Sequence:CCGGGGACGACGAAGTGGAATTATTCTCGAGAATAATTCCACTTCGTCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080494.1-1154s21c1
Sequence:CCGGGGTCCAAGGCCACCTACATTTCTCGAGAAATGTAGGTGGCCTTGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080494.1-1438s21c1
Sequence:CCGGATACTTGAGATTATCACTAAGCTCGAGCTTAGTGATAATCTCAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153392
TTC39A MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 39A
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153392.1-786s1c1
Sequence:CCGGGTCATGCTGTTGCTGTGTTATCTCGAGATAACACAGCAACAGCATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153392.1-1855s1c1
Sequence:CCGGGCACCTGGAAACATTTCTAAACTCGAGTTTAGAAATGTTTCCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153392.1-1858s1c1
Sequence:CCGGCCTGGAAACATTTCTAAAGATCTCGAGATCTTTAGAAATGTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153392.1-1658s1c1
Sequence:CCGGCAAACTCTTAGAGTCTGCAAACTCGAGTTTGCAGACTCTAAGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153392
TTC39A MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 39A
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153392.1-786s1c1
Sequence:CCGGGTCATGCTGTTGCTGTGTTATCTCGAGATAACACAGCAACAGCATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153392.1-1855s1c1
Sequence:CCGGGCACCTGGAAACATTTCTAAACTCGAGTTTAGAAATGTTTCCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153392.1-1858s1c1
Sequence:CCGGCCTGGAAACATTTCTAAAGATCTCGAGATCTTTAGAAATGTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153392.1-1658s1c1
Sequence:CCGGCAAACTCTTAGAGTCTGCAAACTCGAGTTTGCAGACTCTAAGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153392
TTC39A MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 39A
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153392.1-786s1c1
Sequence:CCGGGTCATGCTGTTGCTGTGTTATCTCGAGATAACACAGCAACAGCATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153392.1-1855s1c1
Sequence:CCGGGCACCTGGAAACATTTCTAAACTCGAGTTTAGAAATGTTTCCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153392.1-1858s1c1
Sequence:CCGGCCTGGAAACATTTCTAAAGATCTCGAGATCTTTAGAAATGTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153392.1-1658s1c1
Sequence:CCGGCAAACTCTTAGAGTCTGCAAACTCGAGTTTGCAGACTCTAAGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks