EMAIL THIS PAGE TO A FRIEND

TTC39B

tetratricopeptide repeat domain 39B

Synonyms: C9orf52
Gene ID:
Mouse(69863) tetratricopeptide repeat domain 39B
Rat(298186) tetratricopeptide repeat domain 39B
chicken(427354) tetratricopeptide repeat domain 39B
domestic cat(101096423) tetratricopeptide repeat domain 39B
dog(474710) tetratricopeptide repeat domain 39B
naked mole-rat(101710731) tetratricopeptide repeat domain 39B
domestic guinea pig(100715523) tetratricopeptide repeat domain 39B
cow(508428) tetratricopeptide repeat domain 39B
sheep(101121659) tetratricopeptide repeat domain 39B
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027238 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027238 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027238 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152574 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152574 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152574 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152574 Rosetta Predictions human pricing
NM_001106665 Rosetta Predictions rat pricing
NM_027238 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152574 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366392 predicted 699
2 SASI_Hs02_00366393 predicted 1429
3 SASI_Hs01_00243482 predicted 1719
4 SASI_Hs01_00243483 predicted 1735
5 SASI_Hs01_00243484 predicted 873
6 SASI_Hs01_00243485 predicted 666
7 SASI_Hs01_00243487 predicted 369
8 SASI_Hs01_00243489 predicted 1769
9 SASI_Hs01_00243490 predicted 432
10 SASI_Hs01_00243491 predicted 412
11 SASI_Hs01_00243486 predicted 304
12 SASI_Hs01_00243488 predicted 602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106665 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221178 predicted 761
2 SASI_Rn02_00221179 predicted 378
3 SASI_Rn02_00221180 predicted 1324
4 SASI_Rn02_00221181 predicted 1203
5 SASI_Rn02_00221182 predicted 1214
6 SASI_Rn02_00221183 predicted 1919
7 SASI_Rn02_00221184 predicted 676
8 SASI_Rn02_00221185 predicted 394
9 SASI_Rn02_00221186 predicted 452
10 SASI_Rn02_00221187 predicted 730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027238 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190279 predicted 628
2 SASI_Mm01_00190280 predicted 841
3 SASI_Mm01_00190281 predicted 1276
4 SASI_Mm01_00190282 predicted 1617
5 SASI_Mm02_00331806 predicted 1924
6 SASI_Mm01_00190283 predicted 1966
7 SASI_Mm01_00190284 predicted 684
8 SASI_Mm01_00190286 predicted 1186
9 SASI_Mm01_00190287 predicted 1743
10 SASI_Mm01_00190288 predicted 1255
11 SASI_Mm01_00190285 predicted 1335
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027238
VALIDATED
TTC39B MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 39B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027238.1-1034s1c1
Sequence:CCGGCGTTCCTTCAACAGTTCCCAACTCGAGTTGGGAACTGTTGAAGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027238.1-179s1c1
Sequence:CCGGGCGGCTTTCACTTTGTACCATCTCGAGATGGTACAAAGTGAAAGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027238.1-307s1c1
Sequence:CCGGGCACTGAACTTATTTCTAAGTCTCGAGACTTAGAAATAAGTTCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027238.1-1627s1c1
Sequence:CCGGGATGATGAATGCTTGGTGAAACTCGAGTTTCACCAAGCATTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200556    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027238.1-2014s1c1
Sequence:CCGGCCATGATCCATCAAATAAGAACTCGAGTTCTTATTTGATGGATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027238.2-1764s21c1
Sequence:CCGGACGCTGTTTGAGTTGGCATTTCTCGAGAAATGCCAACTCAAACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027238.2-1833s21c1
Sequence:CCGGACTGCAAGAAATAACTATAAGCTCGAGCTTATAGTTATTTCTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279587    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027238.2-2197s21c1
Sequence:CCGGGGTACAATAAAGCCTAGTTAGCTCGAGCTAACTAGGCTTTATTGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027238.2-1222s21c1
Sequence:CCGGGGATGCAGGCGTATTACTATTCTCGAGAATAGTAATACGCCTGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027238.2-306s21c1
Sequence:CCGGGCACTGAACTTATTTCTAAGTCTCGAGACTTAGAAATAAGTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027238
VALIDATED
TTC39B MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 39B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027238.1-1034s1c1
Sequence:CCGGCGTTCCTTCAACAGTTCCCAACTCGAGTTGGGAACTGTTGAAGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027238.1-179s1c1
Sequence:CCGGGCGGCTTTCACTTTGTACCATCTCGAGATGGTACAAAGTGAAAGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027238.1-307s1c1
Sequence:CCGGGCACTGAACTTATTTCTAAGTCTCGAGACTTAGAAATAAGTTCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027238.1-1627s1c1
Sequence:CCGGGATGATGAATGCTTGGTGAAACTCGAGTTTCACCAAGCATTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200556    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027238.1-2014s1c1
Sequence:CCGGCCATGATCCATCAAATAAGAACTCGAGTTCTTATTTGATGGATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027238.2-1764s21c1
Sequence:CCGGACGCTGTTTGAGTTGGCATTTCTCGAGAAATGCCAACTCAAACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027238.2-1833s21c1
Sequence:CCGGACTGCAAGAAATAACTATAAGCTCGAGCTTATAGTTATTTCTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279587    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027238.2-2197s21c1
Sequence:CCGGGGTACAATAAAGCCTAGTTAGCTCGAGCTAACTAGGCTTTATTGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027238.2-1222s21c1
Sequence:CCGGGGATGCAGGCGTATTACTATTCTCGAGAATAGTAATACGCCTGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027238.2-306s21c1
Sequence:CCGGGCACTGAACTTATTTCTAAGTCTCGAGACTTAGAAATAAGTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027238
VALIDATED
TTC39B MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 39B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027238.1-1034s1c1
Sequence:CCGGCGTTCCTTCAACAGTTCCCAACTCGAGTTGGGAACTGTTGAAGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027238.1-179s1c1
Sequence:CCGGGCGGCTTTCACTTTGTACCATCTCGAGATGGTACAAAGTGAAAGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027238.1-307s1c1
Sequence:CCGGGCACTGAACTTATTTCTAAGTCTCGAGACTTAGAAATAAGTTCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027238.1-1627s1c1
Sequence:CCGGGATGATGAATGCTTGGTGAAACTCGAGTTTCACCAAGCATTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200556    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027238.1-2014s1c1
Sequence:CCGGCCATGATCCATCAAATAAGAACTCGAGTTCTTATTTGATGGATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027238.2-1764s21c1
Sequence:CCGGACGCTGTTTGAGTTGGCATTTCTCGAGAAATGCCAACTCAAACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027238.2-1833s21c1
Sequence:CCGGACTGCAAGAAATAACTATAAGCTCGAGCTTATAGTTATTTCTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279587    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027238.2-2197s21c1
Sequence:CCGGGGTACAATAAAGCCTAGTTAGCTCGAGCTAACTAGGCTTTATTGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027238.2-1222s21c1
Sequence:CCGGGGATGCAGGCGTATTACTATTCTCGAGAATAGTAATACGCCTGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027238.2-306s21c1
Sequence:CCGGGCACTGAACTTATTTCTAAGTCTCGAGACTTAGAAATAAGTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152574
TTC39B MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 39B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152574.1-1877s1c1
Sequence:CCGGGCAAGGAACAACTACAAAGATCTCGAGATCTTTGTAGTTGTTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152574.1-407s1c1
Sequence:CCGGGCTAAGGAGAGTATGTACCATCTCGAGATGGTACATACTCTCCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152574.1-869s1c1
Sequence:CCGGCCAGCAAGGATTATCAGACTACTCGAGTAGTCTGATAATCCTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152574.1-1775s1c1
Sequence:CCGGCTGAAGTATGACCACTACCTACTCGAGTAGGTAGTGGTCATACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148327    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152574.1-2008s1c1
Sequence:CCGGCATCGGCATCTGCTATAGATTCTCGAGAATCTATAGCAGATGCCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146417    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152574.1-2011s1c1
Sequence:CCGGCGGCATCTGCTATAGATTCAACTCGAGTTGAATCTATAGCAGATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152574.1-1196s1c1
Sequence:CCGGGAATGGAAACAGTTTCACCATCTCGAGATGGTGAAACTGTTTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152574
TTC39B MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 39B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152574.1-1877s1c1
Sequence:CCGGGCAAGGAACAACTACAAAGATCTCGAGATCTTTGTAGTTGTTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152574.1-407s1c1
Sequence:CCGGGCTAAGGAGAGTATGTACCATCTCGAGATGGTACATACTCTCCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152574.1-869s1c1
Sequence:CCGGCCAGCAAGGATTATCAGACTACTCGAGTAGTCTGATAATCCTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152574.1-1775s1c1
Sequence:CCGGCTGAAGTATGACCACTACCTACTCGAGTAGGTAGTGGTCATACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148327    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152574.1-2008s1c1
Sequence:CCGGCATCGGCATCTGCTATAGATTCTCGAGAATCTATAGCAGATGCCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146417    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152574.1-2011s1c1
Sequence:CCGGCGGCATCTGCTATAGATTCAACTCGAGTTGAATCTATAGCAGATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152574.1-1196s1c1
Sequence:CCGGGAATGGAAACAGTTTCACCATCTCGAGATGGTGAAACTGTTTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152574
TTC39B MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 39B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152574.1-1877s1c1
Sequence:CCGGGCAAGGAACAACTACAAAGATCTCGAGATCTTTGTAGTTGTTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152574.1-407s1c1
Sequence:CCGGGCTAAGGAGAGTATGTACCATCTCGAGATGGTACATACTCTCCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152574.1-869s1c1
Sequence:CCGGCCAGCAAGGATTATCAGACTACTCGAGTAGTCTGATAATCCTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152574.1-1775s1c1
Sequence:CCGGCTGAAGTATGACCACTACCTACTCGAGTAGGTAGTGGTCATACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148327    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152574.1-2008s1c1
Sequence:CCGGCATCGGCATCTGCTATAGATTCTCGAGAATCTATAGCAGATGCCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146417    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152574.1-2011s1c1
Sequence:CCGGCGGCATCTGCTATAGATTCAACTCGAGTTGAATCTATAGCAGATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152574.1-1196s1c1
Sequence:CCGGGAATGGAAACAGTTTCACCATCTCGAGATGGTGAAACTGTTTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks