EMAIL THIS PAGE TO A FRIEND

TTC39C

tetratricopeptide repeat domain 39C

Synonyms: C18orf17 HsT2697
UniProtKB ID: Q8N584, B7WP63, J3QRR1, Q0VAJ2, Q8N284
Gene ID:
Mouse(72747) tetratricopeptide repeat domain 39C
cow(532895) tetratricopeptide repeat domain 39C
sheep(101119866) tetratricopeptide repeat domain 39C
domestic guinea pig(100717017) tetratricopeptide repeat domain 39C
naked mole-rat(101709034) tetratricopeptide repeat domain 39C
Zebrafish(553591) tetratricopeptide repeat domain 39C
chicken(421077) tetratricopeptide repeat domain 39C
domestic cat(101097428) tetratricopeptide repeat domain 39C
Horse(100063448) tetratricopeptide repeat domain 39C
dog(480172) tetratricopeptide repeat domain 39C
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153211 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153211 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153211 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028341 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028341 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028341 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153211 Rosetta Predictions human pricing
NM_028341 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153211 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087120 predicted 400
2 SASI_Hs01_00087121 predicted 1829
3 SASI_Hs01_00087122 predicted 1063
4 SASI_Hs01_00087123 predicted 1616
5 SASI_Hs01_00087124 predicted 1177
6 SASI_Hs01_00087125 predicted 540
7 SASI_Hs01_00087126 predicted 1161
8 SASI_Hs01_00087127 predicted 1411
9 SASI_Hs02_00367071 predicted 1196
10 SASI_Hs01_00087129 predicted 466
11 SASI_Hs01_00087128 predicted 1216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028341 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086001 predicted 650
2 SASI_Mm01_00086002 predicted 376
3 SASI_Mm01_00086003 predicted 1804
4 SASI_Mm01_00086004 predicted 1146
5 SASI_Mm01_00086005 predicted 1610
6 SASI_Mm01_00086006 predicted 959
7 SASI_Mm01_00086007 predicted 1711
8 SASI_Mm01_00086008 predicted 1245
9 SASI_Mm01_00086009 predicted 240
10 SASI_Mm01_00086010 predicted 411
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153211
TTC39C MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 39C
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153211.3-1766s21c1
Sequence:CCGGATTTCTCTGGCTACGACTTTGCTCGAGCAAAGTCGTAGCCAGAGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153211.3-350s21c1
Sequence:CCGGAGTTGGCATGTGATGACTTAACTCGAGTTAAGTCATCACATGCCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153211.3-1071s21c1
Sequence:CCGGACAACGACTAGAGTGTCAAATCTCGAGATTTGACACTCTAGTCGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153211.1-672s1c1
Sequence:CCGGCTTGACTTCTGATGCTGCAAACTCGAGTTTGCAGCATCAGAAGTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153211.1-1639s1c1
Sequence:CCGGGATGAATTGTGTCGTCAGAATCTCGAGATTCTGACGACACAATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153211.1-1257s1c1
Sequence:CCGGCCAGTGCTATTATGCCTACTTCTCGAGAAGTAGGCATAATAGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153211.1-319s1c1
Sequence:CCGGGCCATGATGACATTTGAGGAACTCGAGTTCCTCAAATGTCATCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153211.1-1445s1c1
Sequence:CCGGCGTCTATTGAAGTGTTGTACTCTCGAGAGTACAACACTTCAATAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128943    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153211.1-1978s1c1
Sequence:CCGGCCCAGTTAAGCTGACATATTACTCGAGTAATATGTCAGCTTAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127768    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153211.1-2045s1c1
Sequence:CCGGGAGGAGGATGATGATGGTAATCTCGAGATTACCATCATCATCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153211
TTC39C MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 39C
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153211.3-1766s21c1
Sequence:CCGGATTTCTCTGGCTACGACTTTGCTCGAGCAAAGTCGTAGCCAGAGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153211.3-350s21c1
Sequence:CCGGAGTTGGCATGTGATGACTTAACTCGAGTTAAGTCATCACATGCCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153211.3-1071s21c1
Sequence:CCGGACAACGACTAGAGTGTCAAATCTCGAGATTTGACACTCTAGTCGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153211.1-672s1c1
Sequence:CCGGCTTGACTTCTGATGCTGCAAACTCGAGTTTGCAGCATCAGAAGTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153211.1-1639s1c1
Sequence:CCGGGATGAATTGTGTCGTCAGAATCTCGAGATTCTGACGACACAATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153211.1-1257s1c1
Sequence:CCGGCCAGTGCTATTATGCCTACTTCTCGAGAAGTAGGCATAATAGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153211.1-319s1c1
Sequence:CCGGGCCATGATGACATTTGAGGAACTCGAGTTCCTCAAATGTCATCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153211.1-1445s1c1
Sequence:CCGGCGTCTATTGAAGTGTTGTACTCTCGAGAGTACAACACTTCAATAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128943    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153211.1-1978s1c1
Sequence:CCGGCCCAGTTAAGCTGACATATTACTCGAGTAATATGTCAGCTTAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127768    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153211.1-2045s1c1
Sequence:CCGGGAGGAGGATGATGATGGTAATCTCGAGATTACCATCATCATCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153211
TTC39C MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 39C
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153211.3-1766s21c1
Sequence:CCGGATTTCTCTGGCTACGACTTTGCTCGAGCAAAGTCGTAGCCAGAGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153211.3-350s21c1
Sequence:CCGGAGTTGGCATGTGATGACTTAACTCGAGTTAAGTCATCACATGCCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153211.3-1071s21c1
Sequence:CCGGACAACGACTAGAGTGTCAAATCTCGAGATTTGACACTCTAGTCGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153211.1-672s1c1
Sequence:CCGGCTTGACTTCTGATGCTGCAAACTCGAGTTTGCAGCATCAGAAGTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153211.1-1639s1c1
Sequence:CCGGGATGAATTGTGTCGTCAGAATCTCGAGATTCTGACGACACAATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153211.1-1257s1c1
Sequence:CCGGCCAGTGCTATTATGCCTACTTCTCGAGAAGTAGGCATAATAGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153211.1-319s1c1
Sequence:CCGGGCCATGATGACATTTGAGGAACTCGAGTTCCTCAAATGTCATCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153211.1-1445s1c1
Sequence:CCGGCGTCTATTGAAGTGTTGTACTCTCGAGAGTACAACACTTCAATAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128943    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153211.1-1978s1c1
Sequence:CCGGCCCAGTTAAGCTGACATATTACTCGAGTAATATGTCAGCTTAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127768    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153211.1-2045s1c1
Sequence:CCGGGAGGAGGATGATGATGGTAATCTCGAGATTACCATCATCATCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028341
VALIDATED
TTC39C MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 39C
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028341.3-173s21c1
Sequence:CCGGGGCCTTGGCTGGCATCAATATCTCGAGATATTGATGCCAGCCAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028341.3-1955s21c1
Sequence:CCGGGTCACTGACATACTAAAGATTCTCGAGAATCTTTAGTATGTCAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028341.3-1162s21c1
Sequence:CCGGGCAGCATGATTGAACTCAACTCTCGAGAGTTGAGTTCAATCATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028341.4-597s21c1
Sequence:CCGGTTGGCGTGCGATGACTTAAAGCTCGAGCTTTAAGTCATCGCACGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028341.4-1316s21c1
Sequence:CCGGCCAGCGGTTAGAGTGTCAAATCTCGAGATTTGACACTCTAACCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028341.4-1782s21c1
Sequence:CCGGGATTCATCTGTCGTTGGATTACTCGAGTAATCCAACGACAGATGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028341.1-1164s1c1
Sequence:CCGGGCAGCATGATTGAACTCAACTCTCGAGAGTTGAGTTCAATCATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028341.1-1957s1c1
Sequence:CCGGGTCACTGACATACTAAAGATTCTCGAGAATCTTTAGTATGTCAGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028341.1-966s1c1
Sequence:CCGGGCTTGGATGAAGCTAAGGCAACTCGAGTTGCCTTAGCTTCATCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176817    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028341.1-1963s1c1
Sequence:CCGGGACATACTAAAGATTCCTCTTCTCGAGAAGAGGAATCTTTAGTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028341.1-244s1c1
Sequence:CCGGCAGAAATCATAGTCCACTAATCTCGAGATTAGTGGACTATGATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028341
VALIDATED
TTC39C MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 39C
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028341.3-173s21c1
Sequence:CCGGGGCCTTGGCTGGCATCAATATCTCGAGATATTGATGCCAGCCAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028341.3-1955s21c1
Sequence:CCGGGTCACTGACATACTAAAGATTCTCGAGAATCTTTAGTATGTCAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028341.3-1162s21c1
Sequence:CCGGGCAGCATGATTGAACTCAACTCTCGAGAGTTGAGTTCAATCATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028341.4-597s21c1
Sequence:CCGGTTGGCGTGCGATGACTTAAAGCTCGAGCTTTAAGTCATCGCACGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028341.4-1316s21c1
Sequence:CCGGCCAGCGGTTAGAGTGTCAAATCTCGAGATTTGACACTCTAACCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028341.4-1782s21c1
Sequence:CCGGGATTCATCTGTCGTTGGATTACTCGAGTAATCCAACGACAGATGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028341.1-1164s1c1
Sequence:CCGGGCAGCATGATTGAACTCAACTCTCGAGAGTTGAGTTCAATCATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028341.1-1957s1c1
Sequence:CCGGGTCACTGACATACTAAAGATTCTCGAGAATCTTTAGTATGTCAGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028341.1-966s1c1
Sequence:CCGGGCTTGGATGAAGCTAAGGCAACTCGAGTTGCCTTAGCTTCATCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176817    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028341.1-1963s1c1
Sequence:CCGGGACATACTAAAGATTCCTCTTCTCGAGAAGAGGAATCTTTAGTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028341.1-244s1c1
Sequence:CCGGCAGAAATCATAGTCCACTAATCTCGAGATTAGTGGACTATGATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028341
VALIDATED
TTC39C MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 39C
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028341.3-173s21c1
Sequence:CCGGGGCCTTGGCTGGCATCAATATCTCGAGATATTGATGCCAGCCAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028341.3-1955s21c1
Sequence:CCGGGTCACTGACATACTAAAGATTCTCGAGAATCTTTAGTATGTCAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028341.3-1162s21c1
Sequence:CCGGGCAGCATGATTGAACTCAACTCTCGAGAGTTGAGTTCAATCATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028341.4-597s21c1
Sequence:CCGGTTGGCGTGCGATGACTTAAAGCTCGAGCTTTAAGTCATCGCACGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028341.4-1316s21c1
Sequence:CCGGCCAGCGGTTAGAGTGTCAAATCTCGAGATTTGACACTCTAACCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028341.4-1782s21c1
Sequence:CCGGGATTCATCTGTCGTTGGATTACTCGAGTAATCCAACGACAGATGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028341.1-1164s1c1
Sequence:CCGGGCAGCATGATTGAACTCAACTCTCGAGAGTTGAGTTCAATCATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028341.1-1957s1c1
Sequence:CCGGGTCACTGACATACTAAAGATTCTCGAGAATCTTTAGTATGTCAGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028341.1-966s1c1
Sequence:CCGGGCTTGGATGAAGCTAAGGCAACTCGAGTTGCCTTAGCTTCATCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176817    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028341.1-1963s1c1
Sequence:CCGGGACATACTAAAGATTCCTCTTCTCGAGAAGAGGAATCTTTAGTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028341.1-244s1c1
Sequence:CCGGCAGAAATCATAGTCCACTAATCTCGAGATTAGTGGACTATGATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks