EMAIL THIS PAGE TO A FRIEND

TTC3

tetratricopeptide repeat domain 3

Synonyms: DCRR1 RNF105 TPRDIII
Gene ID:
Mouse(22129) tetratricopeptide repeat domain 3
Rat(360702) tetratricopeptide repeat domain 3
naked mole-rat(101722149) tetratricopeptide repeat domain 3
Domestic Rabbit(100349795) tetratricopeptide repeat domain 3
domestic guinea pig(100715382) tetratricopeptide repeat domain 3
cow(506569) tetratricopeptide repeat domain 3
sheep(101116444) tetratricopeptide repeat domain 3
chicken(418518) tetratricopeptide repeat domain 3
Horse(100060967) tetratricopeptide repeat domain 3
domestic cat(101081324) tetratricopeptide repeat domain 3
dog(478414) tetratricopeptide repeat domain 3
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009441 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009441 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009441 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003316 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003316 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003316 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001894 Rosetta Predictions human pricing
NM_003316 Rosetta Predictions human pricing
NM_001108315 Rosetta Predictions rat pricing
NM_009441 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303977 predicted 4052
2 SASI_Hs01_00051838 predicted 4337
3 SASI_Hs02_00303978 predicted 537
4 SASI_Hs02_00303979 predicted 1637
5 SASI_Hs02_00303980 predicted 871
6 SASI_Hs02_00303981 predicted 2751
7 SASI_Hs01_00051840 predicted 2873
8 SASI_Hs02_00303982 predicted 3247
9 SASI_Hs01_00051841 predicted 1589
10 SASI_Hs02_00303983 predicted 1571
11 SASI_Hs01_00051839 predicted 5161
12 SASI_Hs01_00051842 predicted 3929
13 SASI_Hs01_00051843 predicted 1245
14 SASI_Hs01_00051844 predicted 4737
15 SASI_Hs01_00051845 predicted 202
16 SASI_Hs01_00051846 predicted 4717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003316 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335440 predicted 5346
2 SASI_Hs01_00230757 predicted 5621
3 SASI_Hs02_00335441 predicted 1834
4 SASI_Hs02_00335442 predicted 2934
5 SASI_Hs02_00335443 predicted 2156
6 SASI_Hs02_00335444 predicted 4044
7 SASI_Hs01_00230759 predicted 4163
8 SASI_Hs02_00335445 predicted 4543
9 SASI_Hs01_00230760 predicted 2879
10 SASI_Hs02_00335446 predicted 2864
11 SASI_Hs01_00230758 predicted 6445
12 SASI_Hs01_00230761 predicted 5213
13 SASI_Hs01_00230762 predicted 2539
14 SASI_Hs01_00230763 predicted 1500
15 SASI_Hs01_00230764 predicted 6009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108315 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237449 predicted 284
2 SASI_Rn02_00237450 predicted 5805
3 SASI_Rn02_00237451 predicted 712
4 SASI_Rn02_00237452 predicted 656
5 SASI_Rn02_00237453 predicted 2259
6 SASI_Rn02_00237454 predicted 4310
7 SASI_Rn02_00237455 predicted 409
8 SASI_Rn02_00237456 predicted 2993
9 SASI_Rn02_00237457 predicted 5236
10 SASI_Rn02_00237458 predicted 3349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009441 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118802 predicted 1463
2 SASI_Mm01_00118804 predicted 3024
3 SASI_Mm02_00316140 predicted 2771
4 SASI_Mm01_00118805 predicted 693
5 SASI_Mm01_00118807 predicted 2915
6 SASI_Mm01_00118808 predicted 572
7 SASI_Mm01_00118809 predicted 1604
8 SASI_Mm01_00118811 predicted 4231
9 SASI_Mm02_00316141 predicted 413
10 SASI_Mm02_00316142 predicted 1338
11 SASI_Mm01_00118803 predicted 407
12 SASI_Mm01_00118806 predicted 503
13 SASI_Mm01_00118810 predicted 1608
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009441
TTC3 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009441.1-3049s1c1
Sequence:CCGGCGTTTGGTTGTATCAAGGTAACTCGAGTTACCTTGATACAACCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009441.1-6951s1c1
Sequence:CCGGCACTCCTTATTCTGAGACATTCTCGAGAATGTCTCAGAATAAGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191476    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009441.1-6127s1c1
Sequence:CCGGGCTAACAAATGGAAATCTGAACTCGAGTTCAGATTTCCATTTGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009441.1-3612s1c1
Sequence:CCGGCGAGTTAAACTACCACTAAATCTCGAGATTTAGTGGTAGTTTAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009441.2-6239s21c1
Sequence:CCGGTGCATCACAAAGCTAACAAATCTCGAGATTTGTTAGCTTTGTGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009441.2-3398s21c1
Sequence:CCGGCGAGTATGTTGTCCGAAATAACTCGAGTTATTTCGGACAACATACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009441.2-5126s21c1
Sequence:CCGGTCCCGATGTGGAGTATGATATCTCGAGATATCATACTCCACATCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009441.2-2781s21c1
Sequence:CCGGAGAGTAAAGACACGGATATTTCTCGAGAAATATCCGTGTCTTTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009441.2-4112s21c1
Sequence:CCGGGTCGCAGTTCACTAGCATTTACTCGAGTAAATGCTAGTGAACTGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009441
TTC3 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009441.1-3049s1c1
Sequence:CCGGCGTTTGGTTGTATCAAGGTAACTCGAGTTACCTTGATACAACCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009441.1-6951s1c1
Sequence:CCGGCACTCCTTATTCTGAGACATTCTCGAGAATGTCTCAGAATAAGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191476    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009441.1-6127s1c1
Sequence:CCGGGCTAACAAATGGAAATCTGAACTCGAGTTCAGATTTCCATTTGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009441.1-3612s1c1
Sequence:CCGGCGAGTTAAACTACCACTAAATCTCGAGATTTAGTGGTAGTTTAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009441.2-6239s21c1
Sequence:CCGGTGCATCACAAAGCTAACAAATCTCGAGATTTGTTAGCTTTGTGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009441.2-3398s21c1
Sequence:CCGGCGAGTATGTTGTCCGAAATAACTCGAGTTATTTCGGACAACATACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009441.2-5126s21c1
Sequence:CCGGTCCCGATGTGGAGTATGATATCTCGAGATATCATACTCCACATCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009441.2-2781s21c1
Sequence:CCGGAGAGTAAAGACACGGATATTTCTCGAGAAATATCCGTGTCTTTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009441.2-4112s21c1
Sequence:CCGGGTCGCAGTTCACTAGCATTTACTCGAGTAAATGCTAGTGAACTGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009441
TTC3 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009441.1-3049s1c1
Sequence:CCGGCGTTTGGTTGTATCAAGGTAACTCGAGTTACCTTGATACAACCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009441.1-6951s1c1
Sequence:CCGGCACTCCTTATTCTGAGACATTCTCGAGAATGTCTCAGAATAAGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191476    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009441.1-6127s1c1
Sequence:CCGGGCTAACAAATGGAAATCTGAACTCGAGTTCAGATTTCCATTTGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009441.1-3612s1c1
Sequence:CCGGCGAGTTAAACTACCACTAAATCTCGAGATTTAGTGGTAGTTTAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009441.2-6239s21c1
Sequence:CCGGTGCATCACAAAGCTAACAAATCTCGAGATTTGTTAGCTTTGTGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009441.2-3398s21c1
Sequence:CCGGCGAGTATGTTGTCCGAAATAACTCGAGTTATTTCGGACAACATACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009441.2-5126s21c1
Sequence:CCGGTCCCGATGTGGAGTATGATATCTCGAGATATCATACTCCACATCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009441.2-2781s21c1
Sequence:CCGGAGAGTAAAGACACGGATATTTCTCGAGAAATATCCGTGTCTTTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009441.2-4112s21c1
Sequence:CCGGGTCGCAGTTCACTAGCATTTACTCGAGTAAATGCTAGTGAACTGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003316
VALIDATED
TTC3 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003316.x-5695s1c1
Sequence:CCGGGCTCTTTGGGAATATCTGTAACTCGAGTTACAGATATTCCCAAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003316.x-3126s1c1
Sequence:CCGGGAGGAATTATCTGAAGCCGAACTCGAGTTCGGCTTCAGATAATTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003316.x-8759s1c1
Sequence:CCGGGAGTTTATGAGCTGATTTGGTCTCGAGACCAAATCAGCTCATAAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003316.x-3127s1c1
Sequence:CCGGAGGAATTATCTGAAGCCGAAACTCGAGTTTCGGCTTCAGATAATTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003316.x-2706s1c1
Sequence:CCGGGCGGATGAGGCGTTGAAGGTACTCGAGTACCTTCAACGCCTCATCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003316.3-4649s21c1
Sequence:CCGGGACCAACACAGTAACGAATATCTCGAGATATTCGTTACTGTGTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003316.3-5424s21c1
Sequence:CCGGCCCAGTACACCAGCATATATACTCGAGTATATATGCTGGTGTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003316.3-7660s21c1
Sequence:CCGGATTGCCAACAGTGGCTAATAACTCGAGTTATTAGCCACTGTTGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003316.3-2521s21c1
Sequence:CCGGGAGTTTATCAGCACCTATATTCTCGAGAATATAGGTGCTGATAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003316.3-5825s21c1
Sequence:CCGGGTCAATACTGAGCCATATAATCTCGAGATTATATGGCTCAGTATTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003316.3-6012s21c1
Sequence:CCGGAGATCTCAAAGACGGAATTAGCTCGAGCTAATTCCGTCTTTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003316.3-7921s21c1
Sequence:CCGGTATTCCTGATATGCCTATATTCTCGAGAATATAGGCATATCAGGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003316
VALIDATED
TTC3 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003316.x-5695s1c1
Sequence:CCGGGCTCTTTGGGAATATCTGTAACTCGAGTTACAGATATTCCCAAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003316.x-3126s1c1
Sequence:CCGGGAGGAATTATCTGAAGCCGAACTCGAGTTCGGCTTCAGATAATTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003316.x-8759s1c1
Sequence:CCGGGAGTTTATGAGCTGATTTGGTCTCGAGACCAAATCAGCTCATAAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003316.x-3127s1c1
Sequence:CCGGAGGAATTATCTGAAGCCGAAACTCGAGTTTCGGCTTCAGATAATTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003316.x-2706s1c1
Sequence:CCGGGCGGATGAGGCGTTGAAGGTACTCGAGTACCTTCAACGCCTCATCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003316.3-4649s21c1
Sequence:CCGGGACCAACACAGTAACGAATATCTCGAGATATTCGTTACTGTGTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003316.3-5424s21c1
Sequence:CCGGCCCAGTACACCAGCATATATACTCGAGTATATATGCTGGTGTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003316.3-7660s21c1
Sequence:CCGGATTGCCAACAGTGGCTAATAACTCGAGTTATTAGCCACTGTTGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003316.3-2521s21c1
Sequence:CCGGGAGTTTATCAGCACCTATATTCTCGAGAATATAGGTGCTGATAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003316.3-5825s21c1
Sequence:CCGGGTCAATACTGAGCCATATAATCTCGAGATTATATGGCTCAGTATTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003316.3-6012s21c1
Sequence:CCGGAGATCTCAAAGACGGAATTAGCTCGAGCTAATTCCGTCTTTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003316.3-7921s21c1
Sequence:CCGGTATTCCTGATATGCCTATATTCTCGAGAATATAGGCATATCAGGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003316
VALIDATED
TTC3 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003316.x-5695s1c1
Sequence:CCGGGCTCTTTGGGAATATCTGTAACTCGAGTTACAGATATTCCCAAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003316.x-3126s1c1
Sequence:CCGGGAGGAATTATCTGAAGCCGAACTCGAGTTCGGCTTCAGATAATTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003316.x-8759s1c1
Sequence:CCGGGAGTTTATGAGCTGATTTGGTCTCGAGACCAAATCAGCTCATAAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003316.x-3127s1c1
Sequence:CCGGAGGAATTATCTGAAGCCGAAACTCGAGTTTCGGCTTCAGATAATTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003316.x-2706s1c1
Sequence:CCGGGCGGATGAGGCGTTGAAGGTACTCGAGTACCTTCAACGCCTCATCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003316.3-4649s21c1
Sequence:CCGGGACCAACACAGTAACGAATATCTCGAGATATTCGTTACTGTGTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003316.3-5424s21c1
Sequence:CCGGCCCAGTACACCAGCATATATACTCGAGTATATATGCTGGTGTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003316.3-7660s21c1
Sequence:CCGGATTGCCAACAGTGGCTAATAACTCGAGTTATTAGCCACTGTTGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003316.3-2521s21c1
Sequence:CCGGGAGTTTATCAGCACCTATATTCTCGAGAATATAGGTGCTGATAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003316.3-5825s21c1
Sequence:CCGGGTCAATACTGAGCCATATAATCTCGAGATTATATGGCTCAGTATTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003316.3-6012s21c1
Sequence:CCGGAGATCTCAAAGACGGAATTAGCTCGAGCTAATTCCGTCTTTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003316.3-7921s21c1
Sequence:CCGGTATTCCTGATATGCCTATATTCTCGAGAATATAGGCATATCAGGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks