EMAIL THIS PAGE TO A FRIEND

TTC40

tetratricopeptide repeat domain 40

Synonyms: C10orf123 C10orf124 C10orf92 C10orf93 RP13-137A17.3 bA288G11.4 bA288G11.5 bB137A17.2 bB137A17.3
Gene ID:
naked mole-rat(101698161) tetratricopeptide repeat domain 40
domestic guinea pig(100728487) tetratricopeptide repeat domain 40
cow(100848865) tetratricopeptide repeat domain 40
sheep(101110287) tetratricopeptide repeat domain 40
cow(514117) tetratricopeptide repeat domain 40
dog(607941) tetratricopeptide repeat domain 40
domestic cat(101087873) tetratricopeptide repeat domain 40
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017609 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017609 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017609 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150261 MISSION® esiRNA esiRNA human C10orf92 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017609 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017609 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221352 predicted 1183
2 SASI_Hs01_00221353 predicted 1655
3 SASI_Hs01_00221355 predicted 2012
4 SASI_Hs01_00221357 predicted 1188
5 SASI_Hs01_00221358 predicted 2042
6 SASI_Hs01_00221359 predicted 1139
7 SASI_Hs01_00221360 predicted 1467
8 SASI_Hs01_00221361 predicted 1504
9 SASI_Hs02_00350278 predicted 2100
10 SASI_Hs02_00350279 predicted 1300
11 SASI_Hs01_00221354 predicted 1624
12 SASI_Hs01_00221356 predicted 545
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017609
TTC40 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 40
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017609.2-1530s1c1
Sequence:CCGGCCTGAGGTTGCCGATAAGATACTCGAGTATCTTATCGGCAACCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017609.2-1657s21c1
Sequence:CCGGTGTGGAATCGCCTCCATAAAGCTCGAGCTTTATGGAGGCGATTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017609.2-2017s21c1
Sequence:CCGGAGAGCTTCCTGTCCCATATATCTCGAGATATATGGGACAGGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017609.2-1531s21c1
Sequence:CCGGCTGAGGTTGCCGATAAGATAGCTCGAGCTATCTTATCGGCAACCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017609.2-1604s21c1
Sequence:CCGGGTTCGATGAAGGGACAATTTCCTCGAGGAAATTGTCCCTTCATCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017609
TTC40 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 40
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017609.2-1530s1c1
Sequence:CCGGCCTGAGGTTGCCGATAAGATACTCGAGTATCTTATCGGCAACCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017609.2-1657s21c1
Sequence:CCGGTGTGGAATCGCCTCCATAAAGCTCGAGCTTTATGGAGGCGATTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017609.2-2017s21c1
Sequence:CCGGAGAGCTTCCTGTCCCATATATCTCGAGATATATGGGACAGGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017609.2-1531s21c1
Sequence:CCGGCTGAGGTTGCCGATAAGATAGCTCGAGCTATCTTATCGGCAACCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017609.2-1604s21c1
Sequence:CCGGGTTCGATGAAGGGACAATTTCCTCGAGGAAATTGTCCCTTCATCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017609
TTC40 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 40
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017609.2-1530s1c1
Sequence:CCGGCCTGAGGTTGCCGATAAGATACTCGAGTATCTTATCGGCAACCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017609.2-1657s21c1
Sequence:CCGGTGTGGAATCGCCTCCATAAAGCTCGAGCTTTATGGAGGCGATTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017609.2-2017s21c1
Sequence:CCGGAGAGCTTCCTGTCCCATATATCTCGAGATATATGGGACAGGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017609.2-1531s21c1
Sequence:CCGGCTGAGGTTGCCGATAAGATAGCTCGAGCTATCTTATCGGCAACCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017609.2-1604s21c1
Sequence:CCGGGTTCGATGAAGGGACAATTTCCTCGAGGAAATTGTCCCTTCATCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks