EMAIL THIS PAGE TO A FRIEND

TTC4

tetratricopeptide repeat domain 4

UniProtKB ID: O95801, Q53Y95, Q5TA96, Q9H3I2
Gene ID:
Human(7268) Summary: This gene encodes a protein that contains tetratricopeptide (TPR) repeats. The 34-amino acid tetratricopeptide repeat motifs are found in a variety of proteins and may mediate protein-protein interactions and chaperone activity.[provided by RefSeq, Jun 2011]
Mouse(72354) tetratricopeptide repeat domain 4
Rat(362556) tetratricopeptide repeat domain 4
Zebrafish(393981) tetratricopeptide repeat domain 4
domestic cat(101098242) tetratricopeptide repeat domain 4
dog(610555) tetratricopeptide repeat domain 4
chicken(429109) tetratricopeptide repeat domain 4
cow(509047) tetratricopeptide repeat domain 4
sheep(101122395) tetratricopeptide repeat domain 4
domestic guinea pig(100714276) tetratricopeptide repeat domain 4
naked mole-rat(101709617) tetratricopeptide repeat domain 4
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028209 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028209 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028209 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004623 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004623 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004623 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004623 Rosetta Predictions human pricing
NM_001013214 Rosetta Predictions rat pricing
NM_028209 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004623 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051988 predicted 503
2 SASI_Hs01_00051989 predicted 1285
3 SASI_Hs01_00051990 predicted 886
4 SASI_Hs01_00051991 predicted 334
5 SASI_Hs01_00051992 predicted 332
6 SASI_Hs01_00051993 predicted 667
7 SASI_Hs01_00051994 predicted 1270
8 SASI_Hs01_00051995 predicted 642
9 SASI_Hs01_00051996 predicted 768
10 SASI_Hs01_00051997 predicted 1009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013214 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086355 predicted 541
2 SASI_Rn02_00201007 predicted 1006
3 SASI_Rn01_00086356 predicted 387
4 SASI_Rn01_00086358 predicted 978
5 SASI_Rn01_00086359 predicted 900
6 SASI_Rn01_00086360 predicted 252
7 SASI_Rn01_00086361 predicted 555
8 SASI_Rn01_00086362 predicted 959
9 SASI_Rn01_00086363 predicted 571
10 SASI_Rn01_00086364 predicted 997
11 SASI_Rn01_00086357 predicted 981
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028209 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125639 predicted 560
2 SASI_Mm01_00125640 predicted 1269
3 SASI_Mm01_00125641 predicted 266
4 SASI_Mm01_00125642 predicted 574
5 SASI_Mm01_00125643 predicted 545
6 SASI_Mm02_00333532 predicted 605
7 SASI_Mm01_00125644 predicted 406
8 SASI_Mm01_00125645 predicted 579
9 SASI_Mm01_00125646 predicted 937
10 SASI_Mm01_00125647 predicted 708
11 SASI_Mm01_00125648 predicted 748
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028209
VALIDATED
TTC4 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028209.1-260s21c1
Sequence:CCGGAGCAAGCCAAGACCTATAAAGCTCGAGCTTTATAGGTCTTGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028209.1-1143s21c1
Sequence:CCGGCTCGCCTTTCTGTAGGAATTACTCGAGTAATTCCTACAGAAAGGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028209.1-1143s1c1
Sequence:CCGGCTCGCCTTTCTGTAGGAATTACTCGAGTAATTCCTACAGAAAGGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028209.1-938s21c1
Sequence:CCGGACCATCTAATGGCGATGTTTACTCGAGTAAACATCGCCATTAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028209.1-817s21c1
Sequence:CCGGTATGGAGCCAGGCTAAGTATACTCGAGTATACTTAGCCTGGCTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028209.1-1556s21c1
Sequence:CCGGGCACAACTCCAAGGCAATAAACTCGAGTTTATTGCCTTGGAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028209.1-504s1c1
Sequence:CCGGCCTGTGCCATCTTGAACTGAACTCGAGTTCAGTTCAAGATGGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028209.1-406s1c1
Sequence:CCGGGCACAGTACTATCTCGGCAATCTCGAGATTGCCGAGATAGTACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028209
VALIDATED
TTC4 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028209.1-260s21c1
Sequence:CCGGAGCAAGCCAAGACCTATAAAGCTCGAGCTTTATAGGTCTTGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028209.1-1143s21c1
Sequence:CCGGCTCGCCTTTCTGTAGGAATTACTCGAGTAATTCCTACAGAAAGGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028209.1-1143s1c1
Sequence:CCGGCTCGCCTTTCTGTAGGAATTACTCGAGTAATTCCTACAGAAAGGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028209.1-938s21c1
Sequence:CCGGACCATCTAATGGCGATGTTTACTCGAGTAAACATCGCCATTAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028209.1-817s21c1
Sequence:CCGGTATGGAGCCAGGCTAAGTATACTCGAGTATACTTAGCCTGGCTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028209.1-1556s21c1
Sequence:CCGGGCACAACTCCAAGGCAATAAACTCGAGTTTATTGCCTTGGAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028209.1-504s1c1
Sequence:CCGGCCTGTGCCATCTTGAACTGAACTCGAGTTCAGTTCAAGATGGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028209.1-406s1c1
Sequence:CCGGGCACAGTACTATCTCGGCAATCTCGAGATTGCCGAGATAGTACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028209
VALIDATED
TTC4 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028209.1-260s21c1
Sequence:CCGGAGCAAGCCAAGACCTATAAAGCTCGAGCTTTATAGGTCTTGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028209.1-1143s21c1
Sequence:CCGGCTCGCCTTTCTGTAGGAATTACTCGAGTAATTCCTACAGAAAGGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028209.1-1143s1c1
Sequence:CCGGCTCGCCTTTCTGTAGGAATTACTCGAGTAATTCCTACAGAAAGGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028209.1-938s21c1
Sequence:CCGGACCATCTAATGGCGATGTTTACTCGAGTAAACATCGCCATTAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028209.1-817s21c1
Sequence:CCGGTATGGAGCCAGGCTAAGTATACTCGAGTATACTTAGCCTGGCTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028209.1-1556s21c1
Sequence:CCGGGCACAACTCCAAGGCAATAAACTCGAGTTTATTGCCTTGGAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028209.1-504s1c1
Sequence:CCGGCCTGTGCCATCTTGAACTGAACTCGAGTTCAGTTCAAGATGGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028209.1-406s1c1
Sequence:CCGGGCACAGTACTATCTCGGCAATCTCGAGATTGCCGAGATAGTACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004623
VALIDATED
TTC4 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 4
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004623.3-236s21c1
Sequence:CCGGGGCTTGTCTCCAGTCAATTATCTCGAGATAATTGACTGGAGACAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004623.3-1631s21c1
Sequence:GTACCGGATAGGATTCCAAGGCTTTAAACTCGAGTTTAAAGCCTTGGAATCCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004623.3-947s21c1
Sequence:CCGGCAGGTTTATTGATCATCTAATCTCGAGATTAGATGATCAATAAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004623.3-304s21c1
Sequence:CCGGATGAGGGCAATGATTACTTTACTCGAGTAAAGTAATCATTGCCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004623.3-282s21c1
Sequence:CCGGGAACAGGCCAAGACCTATAAACTCGAGTTTATAGGTCTTGGCCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004623.2-1079s1c1
Sequence:CCGGGCACCAGAGGTACTTTGTAAACTCGAGTTTACAAAGTACCTCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143131    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_004623.2-1635s1c1
Sequence:CCGGCCTGGCCTCAAGTTATTTCATCTCGAGATGAAATAACTTGAGGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004623.2-363s1c1
Sequence:CCGGCCTGATTTGAATGCTGTCCTTCTCGAGAAGGACAGCATTCAAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004623.2-402s1c1
Sequence:CCGGGCACAGTACTATCTGGGCAATCTCGAGATTGCCCAGATAGTACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_004623.2-584s1c1
Sequence:CCGGGCTTCTGGAAATGAGGGCTAACTCGAGTTAGCCCTCATTTCCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142803    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004623.2-1720s1c1
Sequence:CCGGCCACATCTTGCTCTGCATTTACTCGAGTAAATGCAGAGCAAGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004623.2-506s1c1
Sequence:CCGGCCATCTGGAACTGAAACACTTCTCGAGAAGTGTTTCAGTTCCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122779    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004623.2-1719s1c1
Sequence:CCGGGCCACATCTTGCTCTGCATTTCTCGAGAAATGCAGAGCAAGATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_004623.2-1168s1c1
Sequence:CCGGGAAAGGTGTACCAGATACGATCTCGAGATCGTATCTGGTACACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004623.2-210s1c1
Sequence:CCGGGCTTGTCTCCAGTCAATTATTCTCGAGAATAATTGACTGGAGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004623.2-483s1c1
Sequence:CCGGGCAATAATAAGAGGTGCCTTACTCGAGTAAGGCACCTCTTATTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004623.2-472s1c1
Sequence:CCGGGCCACCTCAAAGCAATAATAACTCGAGTTATTATTGCTTTGAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004623
VALIDATED
TTC4 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 4
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004623.3-236s21c1
Sequence:CCGGGGCTTGTCTCCAGTCAATTATCTCGAGATAATTGACTGGAGACAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004623.3-1631s21c1
Sequence:GTACCGGATAGGATTCCAAGGCTTTAAACTCGAGTTTAAAGCCTTGGAATCCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004623.3-947s21c1
Sequence:CCGGCAGGTTTATTGATCATCTAATCTCGAGATTAGATGATCAATAAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004623.3-304s21c1
Sequence:CCGGATGAGGGCAATGATTACTTTACTCGAGTAAAGTAATCATTGCCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004623.3-282s21c1
Sequence:CCGGGAACAGGCCAAGACCTATAAACTCGAGTTTATAGGTCTTGGCCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004623.2-1079s1c1
Sequence:CCGGGCACCAGAGGTACTTTGTAAACTCGAGTTTACAAAGTACCTCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143131    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_004623.2-1635s1c1
Sequence:CCGGCCTGGCCTCAAGTTATTTCATCTCGAGATGAAATAACTTGAGGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004623.2-363s1c1
Sequence:CCGGCCTGATTTGAATGCTGTCCTTCTCGAGAAGGACAGCATTCAAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004623.2-402s1c1
Sequence:CCGGGCACAGTACTATCTGGGCAATCTCGAGATTGCCCAGATAGTACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_004623.2-584s1c1
Sequence:CCGGGCTTCTGGAAATGAGGGCTAACTCGAGTTAGCCCTCATTTCCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142803    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004623.2-1720s1c1
Sequence:CCGGCCACATCTTGCTCTGCATTTACTCGAGTAAATGCAGAGCAAGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004623.2-506s1c1
Sequence:CCGGCCATCTGGAACTGAAACACTTCTCGAGAAGTGTTTCAGTTCCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122779    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004623.2-1719s1c1
Sequence:CCGGGCCACATCTTGCTCTGCATTTCTCGAGAAATGCAGAGCAAGATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_004623.2-1168s1c1
Sequence:CCGGGAAAGGTGTACCAGATACGATCTCGAGATCGTATCTGGTACACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004623.2-210s1c1
Sequence:CCGGGCTTGTCTCCAGTCAATTATTCTCGAGAATAATTGACTGGAGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004623.2-483s1c1
Sequence:CCGGGCAATAATAAGAGGTGCCTTACTCGAGTAAGGCACCTCTTATTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004623.2-472s1c1
Sequence:CCGGGCCACCTCAAAGCAATAATAACTCGAGTTATTATTGCTTTGAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004623
VALIDATED
TTC4 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 4
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004623.3-236s21c1
Sequence:CCGGGGCTTGTCTCCAGTCAATTATCTCGAGATAATTGACTGGAGACAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004623.3-1631s21c1
Sequence:GTACCGGATAGGATTCCAAGGCTTTAAACTCGAGTTTAAAGCCTTGGAATCCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004623.3-947s21c1
Sequence:CCGGCAGGTTTATTGATCATCTAATCTCGAGATTAGATGATCAATAAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004623.3-304s21c1
Sequence:CCGGATGAGGGCAATGATTACTTTACTCGAGTAAAGTAATCATTGCCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004623.3-282s21c1
Sequence:CCGGGAACAGGCCAAGACCTATAAACTCGAGTTTATAGGTCTTGGCCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004623.2-1079s1c1
Sequence:CCGGGCACCAGAGGTACTTTGTAAACTCGAGTTTACAAAGTACCTCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143131    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_004623.2-1635s1c1
Sequence:CCGGCCTGGCCTCAAGTTATTTCATCTCGAGATGAAATAACTTGAGGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004623.2-363s1c1
Sequence:CCGGCCTGATTTGAATGCTGTCCTTCTCGAGAAGGACAGCATTCAAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004623.2-402s1c1
Sequence:CCGGGCACAGTACTATCTGGGCAATCTCGAGATTGCCCAGATAGTACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_004623.2-584s1c1
Sequence:CCGGGCTTCTGGAAATGAGGGCTAACTCGAGTTAGCCCTCATTTCCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142803    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004623.2-1720s1c1
Sequence:CCGGCCACATCTTGCTCTGCATTTACTCGAGTAAATGCAGAGCAAGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004623.2-506s1c1
Sequence:CCGGCCATCTGGAACTGAAACACTTCTCGAGAAGTGTTTCAGTTCCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122779    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004623.2-1719s1c1
Sequence:CCGGGCCACATCTTGCTCTGCATTTCTCGAGAAATGCAGAGCAAGATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_004623.2-1168s1c1
Sequence:CCGGGAAAGGTGTACCAGATACGATCTCGAGATCGTATCTGGTACACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004623.2-210s1c1
Sequence:CCGGGCTTGTCTCCAGTCAATTATTCTCGAGAATAATTGACTGGAGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004623.2-483s1c1
Sequence:CCGGGCAATAATAAGAGGTGCCTTACTCGAGTAAGGCACCTCTTATTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004623.2-472s1c1
Sequence:CCGGGCCACCTCAAAGCAATAATAACTCGAGTTATTATTGCTTTGAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks