EMAIL THIS PAGE TO A FRIEND

TTC5

tetratricopeptide repeat domain 5

Synonyms: Strap
UniProtKB ID: Q8N0Z6, A8MQ18, Q96HF9
Gene ID:
Mouse(219022) tetratricopeptide repeat domain 5
Rat(305837) tetratricopeptide repeat domain 5
Zebrafish(550347) tetratricopeptide repeat domain 5
domestic cat(101100309) tetratricopeptide repeat domain 5
dog(610970) tetratricopeptide repeat domain 5
cow(510757) tetratricopeptide repeat domain 5
sheep(101116233) tetratricopeptide repeat domain 5
domestic guinea pig(100723384) tetratricopeptide repeat domain 5
naked mole-rat(101713791) tetratricopeptide repeat domain 5
Domestic Rabbit(100348168) tetratricopeptide repeat domain 5
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138376 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138376 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138376 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177625 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177625 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177625 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138376 Rosetta Predictions human pricing
NM_001013131 Rosetta Predictions rat pricing
NM_001080949 Rosetta Predictions mouse pricing
NM_177625 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138376 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121707 predicted 1361
2 SASI_Hs01_00121709 predicted 543
3 SASI_Hs02_00363493 predicted 734
4 SASI_Hs01_00121711 predicted 1369
5 SASI_Hs02_00363494 predicted 493
6 SASI_Hs01_00121712 predicted 1217
7 SASI_Hs01_00121713 predicted 243
8 SASI_Hs01_00121714 predicted 579
9 SASI_Hs01_00121715 predicted 1053
10 SASI_Hs01_00121716 predicted 836
11 SASI_Hs01_00121708 predicted 446
12 SASI_Hs01_00121710 predicted 846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013131 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102177 predicted 1096
2 SASI_Rn01_00102178 predicted 871
3 SASI_Rn01_00102179 predicted 1062
4 SASI_Rn02_00200841 predicted 569
5 SASI_Rn01_00102181 predicted 1190
6 SASI_Rn01_00102182 predicted 703
7 SASI_Rn01_00102183 predicted 1369
8 SASI_Rn01_00102184 predicted 244
9 SASI_Rn02_00200842 predicted 1412
10 SASI_Rn02_00200843 predicted 816
11 SASI_Rn01_00102175 predicted 1327
12 SASI_Rn01_00102176 predicted 806
13 SASI_Rn01_00102180 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080949 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294125 predicted 325
2 SASI_Mm02_00294126 predicted 206
3 SASI_Mm02_00294127 predicted 319
4 SASI_Mm02_00294128 predicted 350
5 SASI_Mm02_00294129 predicted 348
6 SASI_Mm02_00294130 predicted 352
7 SASI_Mm02_00294131 predicted 346
8 SASI_Mm02_00294132 predicted 1330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177625 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347858 predicted 324
2 SASI_Mm02_00347859 predicted 203
3 SASI_Mm02_00347860 predicted 326
4 SASI_Mm02_00347861 predicted 351
5 SASI_Mm02_00347862 predicted 348
6 SASI_Mm02_00347863 predicted 351
7 SASI_Mm02_00347864 predicted 340
8 SASI_Mm02_00347865 predicted 824
9 SASI_Mm02_00347866 predicted 813
10 SASI_Mm02_00347867 predicted 1052
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138376
VALIDATED
TTC5 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 5
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138376.2-592s21c1
Sequence:CCGAGGCCGCTCCTGGTATATTCTTCTCGAGAAGAATATACCAGGAGCGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138376.2-290s21c1
Sequence:CCGGTAAATGTGACTCCTGACTATACTCGAGTATAGTCAGGAGTCACATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138376.2-1508s21c1
Sequence:CCGGGCCTGTATTACACTTCGTATCCTCGAGGATACGAAGTGTAATACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138376.2-252s21c1
Sequence:CCGGGGGCAAGGCACAAGTTCTAATCTCGAGATTAGAACTTGTGCCTTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138376.2-741s21c1
Sequence:CCGGGAACAGGGCGACGTTGCATAACTCGAGTTATGCAACGTCGCCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138376.2-115s21c1
Sequence:CCGGGTGGATCAGCTCTACTCATTTCTCGAGAAATGAGTAGAGCTGATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138376.2-141s21c1
Sequence:CCGGCTGCTATTTCGAGACACATAGCTCGAGCTATGTGTCTCGAAATAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156809    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_138376.1-1556s1c1
Sequence:CCGGGCCACATACTCTTCTGGCATACTCGAGTATGCCAGAAGAGTATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_138376.1-868s1c1
Sequence:CCGGCCTCCTTGAGAGTAAGGGAAACTCGAGTTTCCCTTACTCTCAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154209    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_138376.1-1557s1c1
Sequence:CCGGCCACATACTCTTCTGGCATATCTCGAGATATGCCAGAAGAGTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138376.1-1229s1c1
Sequence:CCGGCAGCACAAAGGAAAGGACTATCTCGAGATAGTCCTTTCCTTTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_138376.1-1613s1c1
Sequence:CCGGGCAAAGAGCATGGAATTGGTACTCGAGTACCAATTCCATGCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_138376.1-1136s1c1
Sequence:CCGGGCAGTGATGGTGTACAATATACTCGAGTATATTGTACACCATCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138376.1-242s1c1
Sequence:CCGGGCACAAGTTCTAATGCTAACTCTCGAGAGTTAGCATTAGAACTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138376.1-134s1c1
Sequence:CCGGGAGACACATAGTGTTGAGGATCTCGAGATCCTCAACACTATGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138376
VALIDATED
TTC5 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 5
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138376.2-592s21c1
Sequence:CCGAGGCCGCTCCTGGTATATTCTTCTCGAGAAGAATATACCAGGAGCGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138376.2-290s21c1
Sequence:CCGGTAAATGTGACTCCTGACTATACTCGAGTATAGTCAGGAGTCACATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138376.2-1508s21c1
Sequence:CCGGGCCTGTATTACACTTCGTATCCTCGAGGATACGAAGTGTAATACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138376.2-252s21c1
Sequence:CCGGGGGCAAGGCACAAGTTCTAATCTCGAGATTAGAACTTGTGCCTTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138376.2-741s21c1
Sequence:CCGGGAACAGGGCGACGTTGCATAACTCGAGTTATGCAACGTCGCCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138376.2-115s21c1
Sequence:CCGGGTGGATCAGCTCTACTCATTTCTCGAGAAATGAGTAGAGCTGATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138376.2-141s21c1
Sequence:CCGGCTGCTATTTCGAGACACATAGCTCGAGCTATGTGTCTCGAAATAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156809    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_138376.1-1556s1c1
Sequence:CCGGGCCACATACTCTTCTGGCATACTCGAGTATGCCAGAAGAGTATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_138376.1-868s1c1
Sequence:CCGGCCTCCTTGAGAGTAAGGGAAACTCGAGTTTCCCTTACTCTCAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154209    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_138376.1-1557s1c1
Sequence:CCGGCCACATACTCTTCTGGCATATCTCGAGATATGCCAGAAGAGTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138376.1-1229s1c1
Sequence:CCGGCAGCACAAAGGAAAGGACTATCTCGAGATAGTCCTTTCCTTTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_138376.1-1613s1c1
Sequence:CCGGGCAAAGAGCATGGAATTGGTACTCGAGTACCAATTCCATGCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_138376.1-1136s1c1
Sequence:CCGGGCAGTGATGGTGTACAATATACTCGAGTATATTGTACACCATCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138376.1-242s1c1
Sequence:CCGGGCACAAGTTCTAATGCTAACTCTCGAGAGTTAGCATTAGAACTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138376.1-134s1c1
Sequence:CCGGGAGACACATAGTGTTGAGGATCTCGAGATCCTCAACACTATGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138376
VALIDATED
TTC5 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 5
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138376.2-592s21c1
Sequence:CCGAGGCCGCTCCTGGTATATTCTTCTCGAGAAGAATATACCAGGAGCGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138376.2-290s21c1
Sequence:CCGGTAAATGTGACTCCTGACTATACTCGAGTATAGTCAGGAGTCACATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138376.2-1508s21c1
Sequence:CCGGGCCTGTATTACACTTCGTATCCTCGAGGATACGAAGTGTAATACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138376.2-252s21c1
Sequence:CCGGGGGCAAGGCACAAGTTCTAATCTCGAGATTAGAACTTGTGCCTTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138376.2-741s21c1
Sequence:CCGGGAACAGGGCGACGTTGCATAACTCGAGTTATGCAACGTCGCCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138376.2-115s21c1
Sequence:CCGGGTGGATCAGCTCTACTCATTTCTCGAGAAATGAGTAGAGCTGATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138376.2-141s21c1
Sequence:CCGGCTGCTATTTCGAGACACATAGCTCGAGCTATGTGTCTCGAAATAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156809    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_138376.1-1556s1c1
Sequence:CCGGGCCACATACTCTTCTGGCATACTCGAGTATGCCAGAAGAGTATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_138376.1-868s1c1
Sequence:CCGGCCTCCTTGAGAGTAAGGGAAACTCGAGTTTCCCTTACTCTCAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154209    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_138376.1-1557s1c1
Sequence:CCGGCCACATACTCTTCTGGCATATCTCGAGATATGCCAGAAGAGTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138376.1-1229s1c1
Sequence:CCGGCAGCACAAAGGAAAGGACTATCTCGAGATAGTCCTTTCCTTTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_138376.1-1613s1c1
Sequence:CCGGGCAAAGAGCATGGAATTGGTACTCGAGTACCAATTCCATGCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_138376.1-1136s1c1
Sequence:CCGGGCAGTGATGGTGTACAATATACTCGAGTATATTGTACACCATCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138376.1-242s1c1
Sequence:CCGGGCACAAGTTCTAATGCTAACTCTCGAGAGTTAGCATTAGAACTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138376.1-134s1c1
Sequence:CCGGGAGACACATAGTGTTGAGGATCTCGAGATCCTCAACACTATGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177625
VALIDATED
TTC5 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 5
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000366684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177625.3-498s21c1
Sequence:CCGGACATTCTCGCCACGTCATGGACTCGAGTCCATGACGTGGCGAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177625.3-588s21c1
Sequence:CCGGGGAGAACATCTCCTGGTTTGTCTCGAGACAAACCAGGAGATGTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177625.3-270s21c1
Sequence:CCGGGACTCCTGATTATAGCCCTGACTCGAGTCAGGGCTATAATCAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177625.3-764s21c1
Sequence:CCGGTGGATGCCAGAAGACATTAACCTCGAGGTTAATGTCTTCTGGCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177625.3-1029s21c1
Sequence:CCGGTCTTAGATCTCTTGATTTAAGCTCGAGCTTAAATCAAGAGATCTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177625.3-579s21c1
Sequence:CCGGTGAGTGTTAGGAGAACATCTCCTCGAGGAGATGTTCTCCTAACACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177625.3-568s21c1
Sequence:CCGGCGCTCCTGGTGTGAGTGTTAGCTCGAGCTAACACTCACACCAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177625.2-137s1c1
Sequence:CCGGGCAGGATGTACAGGAAGAGATCTCGAGATCTCTTCCTGTACATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177625.2-396s1c1
Sequence:CCGGCTCACCCACTGCAAGAACAAACTCGAGTTTGTTCTTGCAGTGGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176549    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177625.2-748s1c1
Sequence:CCGGCCAGAAGACATTAACAACATTCTCGAGAATGTTGTTAATGTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177625.2-102s1c1
Sequence:CCGGGAGACACATAGTGTCGAAGATCTCGAGATCTTCGACACTATGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177625
VALIDATED
TTC5 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 5
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000366684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177625.3-498s21c1
Sequence:CCGGACATTCTCGCCACGTCATGGACTCGAGTCCATGACGTGGCGAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177625.3-588s21c1
Sequence:CCGGGGAGAACATCTCCTGGTTTGTCTCGAGACAAACCAGGAGATGTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177625.3-270s21c1
Sequence:CCGGGACTCCTGATTATAGCCCTGACTCGAGTCAGGGCTATAATCAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177625.3-764s21c1
Sequence:CCGGTGGATGCCAGAAGACATTAACCTCGAGGTTAATGTCTTCTGGCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177625.3-1029s21c1
Sequence:CCGGTCTTAGATCTCTTGATTTAAGCTCGAGCTTAAATCAAGAGATCTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177625.3-579s21c1
Sequence:CCGGTGAGTGTTAGGAGAACATCTCCTCGAGGAGATGTTCTCCTAACACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177625.3-568s21c1
Sequence:CCGGCGCTCCTGGTGTGAGTGTTAGCTCGAGCTAACACTCACACCAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177625.2-137s1c1
Sequence:CCGGGCAGGATGTACAGGAAGAGATCTCGAGATCTCTTCCTGTACATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177625.2-396s1c1
Sequence:CCGGCTCACCCACTGCAAGAACAAACTCGAGTTTGTTCTTGCAGTGGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176549    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177625.2-748s1c1
Sequence:CCGGCCAGAAGACATTAACAACATTCTCGAGAATGTTGTTAATGTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177625.2-102s1c1
Sequence:CCGGGAGACACATAGTGTCGAAGATCTCGAGATCTTCGACACTATGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177625
VALIDATED
TTC5 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 5
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000366684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177625.3-498s21c1
Sequence:CCGGACATTCTCGCCACGTCATGGACTCGAGTCCATGACGTGGCGAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177625.3-588s21c1
Sequence:CCGGGGAGAACATCTCCTGGTTTGTCTCGAGACAAACCAGGAGATGTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177625.3-270s21c1
Sequence:CCGGGACTCCTGATTATAGCCCTGACTCGAGTCAGGGCTATAATCAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177625.3-764s21c1
Sequence:CCGGTGGATGCCAGAAGACATTAACCTCGAGGTTAATGTCTTCTGGCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177625.3-1029s21c1
Sequence:CCGGTCTTAGATCTCTTGATTTAAGCTCGAGCTTAAATCAAGAGATCTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177625.3-579s21c1
Sequence:CCGGTGAGTGTTAGGAGAACATCTCCTCGAGGAGATGTTCTCCTAACACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177625.3-568s21c1
Sequence:CCGGCGCTCCTGGTGTGAGTGTTAGCTCGAGCTAACACTCACACCAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177625.2-137s1c1
Sequence:CCGGGCAGGATGTACAGGAAGAGATCTCGAGATCTCTTCCTGTACATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177625.2-396s1c1
Sequence:CCGGCTCACCCACTGCAAGAACAAACTCGAGTTTGTTCTTGCAGTGGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176549    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177625.2-748s1c1
Sequence:CCGGCCAGAAGACATTAACAACATTCTCGAGAATGTTGTTAATGTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177625.2-102s1c1
Sequence:CCGGGAGACACATAGTGTCGAAGATCTCGAGATCTTCGACACTATGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks